Loading...
| piRBase Id | piR-mmu-171387 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 2 |
| Sequence | AAAAAGAAAAGAAAAAAGATCGATTAGCGGA | Number of papers | 5 |
| Length | 31 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 11 | GSM822760 | 4 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 12 | GSM822758 | 16 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 13 | GSM822759 | 6 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
| 14 | GSM822761 | 4 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 16 | GSM822763 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 68 | GSM509277 | 1 | 20439430 | small RNA | Mili-/- E16.5 testis |
| 227 | GSM1528809 | 1 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 2 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 355 | GSM4635228 | 1 | 33184219 | small RNA | primordial germ cells(age: E13.5; sex: male) |
| 443 | GSM1096583 | 1 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 2 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 7:118286683-118286714:+ | SINE B4 RSINE1; | |
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
|---|---|---|---|
| Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
| Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 33184219 | Journal | Genes Dev. 2020 Dec 1;34(23-24):1637-1649. doi: 10.1101/gad.341602.120. Epub 2020 Nov 12. |
|---|---|---|---|
| Title | Sexually dimorphic DNA damage responses and mutation avoidance in the mouse germline. | ||
| Authors | Bloom JC, Schimenti JC. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||