Loading...
piRBase Id | piR-mmu-1694 | Accession | DQ551737 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGGAACTCACAGAGATGCCTCTGCCTC | Number of papers | 13 |
Length | 27 | Golden piRNA | - |
Aliases | piR-19849; PIR12848; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
14 | GSM822761 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
50 | GSM610965 | 2 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
51 | GSM610966 | 15 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
52 | GSM610967 | 1 | 21602304 | small RNA | Male germ cell, Round spermatids |
57 | GSM319953 | 6 | 18922463 | Mili IP | 10 dpp Dnmt3L heterozygotes testis |
58 | GSM319954 | 6 | 18922463 | Mili IP | 10 dpp Dnmt3L KO testis |
70 | GSM509279 | 2 | 20439430 | small RNA | MVH-/- E16.5 testis |
72 | GSM179088 | 1 | 17446352 | Mili IP | 10 dpp testis |
74 | N/A | 1 | 22020280 | Mili IP | Mili_MiliDAH_2 E16.5 fetal testis |
114 | GSM958035 | 1 | 22902560 | Mili IP | Fkbp6 +/-,P0,testis |
117 | GSM958038 | 6 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
118 | GSM958039 | 2 | 22902560 | Mili IP | Tdrd1 +/-,E18,testis |
119 | GSM958040 | 6 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
121 | GSM545783 | 2 | 20534472 | Mov10L1 IP | wild type adult testis |
126 | GSM466728 | 12 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
129 | GSM466729 | 16 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
130 | GSM466730 | 2 | 20059948 | Mili IP | Tdrd9-/- 14dpp testis |
131 | GSM466731 | 2 | 20059948 | Mili IP | Tdrd9-/- 14dpp testis |
133 | GSM475280 | 1 | 20022248 | Mili IP | adult testis |
225 | GSM1528807 | 1 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 2 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 3 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 3 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
346 | GSM475280 | 1 | 20022248 | Mili-IP | testis |
444 | GSM1096600 | 12 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 5 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 26 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
447 | GSM1096585 | 1 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 5 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 3 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 3 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
452 | GSM1096604 | 1 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 10:127697533-127697560:+ | Nemp1 ENSMUST00000048099; | LTR ERVK RMER17B; |
Sample | CPM |
---|---|
GSM179088 | 5.5319 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 4.5227 |
GSM319954 | 2.7895 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 1.864 |
Sample | CPM |
---|---|
GSM400968 | 2.3447 |
GSM400969 | 0.3344 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0.0909 |
GSM475281 | 0 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
---|---|---|---|
Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. |
PubMed | 17446352 | Journal | Science. 2007 May 4;316(5825):744-7. |
---|---|---|---|
Title | Developmentally regulated piRNA clusters implicate MILI in transposon control. | ||
Authors | Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
---|---|---|---|
Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. |
PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
---|---|---|---|
Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |