Loading...

Detail Information of piRNA: piR-mmu-1689

General Information
piRBase Id piR-mmu-1689 Accession DQ721227
Organism Mouse Number of methods 5
Sequence TGGAACGGAAATCAGGTTGGGCAGCGTGA Number of papers 11
Length 29 Golden piRNA -
Aliases piR-19844; piR-136549; PIR12843; PIR229875;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 2 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 11 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 52 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 16 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 20 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
68 GSM509277 1 20439430 small RNA Mili-/- E16.5 testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
121 GSM545783 4 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 20 20022248 Miwi IP adult testis
133 GSM475280 4 20022248 Mili IP adult testis
217 GSM1653802 3 25582079 MIWI CLIP round spermatids
225 GSM1528807 16 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 56 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 40 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 38 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 8 26115953 small RNA 25dpp hetero tdrd6 KO testes
345 GSM475279 20 20022248 Miwi-IP testis 
346 GSM475280 4 20022248 Mili-IP testis 
347 GSM475281 31 20022248 small RNA testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
445 GSM1096584 8 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 58 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 3 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 6 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 6 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 49 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 13 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 22 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:135626898-135626927:+ 1700029M20Rik ENSMUST00000153347; 1700029M20Rik ENSMUST00000134416; 1700029M20Rik ENSMUST00000166316; LTR ERVL-MaLR ORR1A2;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0.4375
GSM433290 1.699
GSM433291 0
GSM433292 2.4313
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 1.921
GSM475280 0.3637
GSM475281 2.9082
GSM678422 0.0531
The Expression of piRNA: piR-mmu-1689
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.