Loading...

Detail Information of piRNA: piR-mmu-1680

General Information
piRBase Id piR-mmu-1680 Accession DQ685474
Organism Mouse Number of methods 5
Sequence TGCTTTGCGGTTGCCTAAAAGCCATGGTC Number of papers 10
Length 29 Golden piRNA -
Aliases piR-19603; piR-100796; PIR12602; PIR190663; PIR194122;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
5 N/A N/A 16751777 MILI IP testis
6 GSM113695 6 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
31 GSM684624 3 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 1 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 4 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
72 GSM179088 1 17446352 Mili IP 10 dpp testis
217 GSM1653802 46 25582079 MIWI CLIP round spermatids
225 GSM1528807 46 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 93 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 142 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 110 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 13 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 12 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 18 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 5 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 56 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 25 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 13 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 10 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 7 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 16 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 22 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 18 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 13 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:113331491-113331520:-
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.0445
GSM433289 2.6249
GSM433290 3.8227
GSM433291 1.7786
GSM433292 4.8626
GSM433293 2.1269
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-1680
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.