Loading...
| piRBase Id | piR-mmu-166 | Accession | DQ539904 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | AAAGTCAGCCCTCGACACAAGGGTTTGT | Number of papers | 11 |
| Length | 28 | Golden piRNA | Y |
| Aliases | piR-16; PIR1015; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 32 | GSM684625 | 3 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 52 | GSM610967 | 1 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 59 | GSM319955 | 19 | 18922463 | small RNA | 16.5 dpc testis |
| 60 | GSM319956 | 1 | 18922463 | Mili IP | 16.5 dpc testis |
| 61 | GSM319957 | 81 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 62 | GSM319958 | 2 | 18922463 | small RNA | 4-6 week ovary |
| 72 | GSM179088 | 10 | 17446352 | Mili IP | 10 dpp testis |
| 132 | GSM475279 | 48 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 37 | 20022248 | Mili IP | adult testis |
| 217 | GSM1653802 | 285 | 25582079 | MIWI CLIP | round spermatids |
| 225 | GSM1528807 | 559 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 407 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 2640 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 1028 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 592 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 1497 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 197 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 1265 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 238 | GSM433292 | 163 | 26115953 | small RNA | 6 weeks hetero tdrd6 KO testes |
| 239 | GSM433293 | 117 | 26115953 | small RNA | 6 weeks homo tdrd6 KO testes |
| 240 | GSM433294 | 382 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
| 241 | GSM433295 | 373 | 26115953 | small RNA | 18.5dpc homo tdrd1 KO testes |
| 246 | GSM1318059 | 9 | 25262350 | small RNA | E16.5 whole testes |
| 247 | GSM1318060 | 16 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
| 345 | GSM475279 | 48 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 37 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 92 | 20022248 | small RNA | testis |
| 441 | GSM1096582 | 14 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 60 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 43 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 2 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 8 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 12 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 2:73868004-73868032:+ | Atf2 ENSMUST00000112016; Atf2 ENSMUST00000112007; Atf2 ENSMUST00000055833; Atf2 ENSMUST00000090802; Atf2 ENSMUST00000112010; Atf2 ENSMUST00000156455; Atf2 ENSMUST00000112017; Atf2 ENSMUST00000143714; Atf2 ENSMUST00000136958; Atf2 ENSMUST00000141050; Atf2 ENSMUST00000154456; Atf2 ENSMUST00000128531; Atf2 ENSMUST00000138098; Atf2 ENSMUST00000125159; | |
| Location 2 | 6:87997229-87997257:- | Gm5577 ENSMUST00000153372; | SINE B2 B3; |
| Location 3 | 9:118674952-118674980:- | Itga9 ENSMUST00000044165; |
| Sample | CPM |
|---|---|
| GSM179088 | 55.3192 |
| GSM261957 | 0 |
| GSM261958 | 157.8372 |
| GSM261959 | 7.5096 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 11.5294 |
| GSM319956 | 2.1202 |
| GSM319957 | 41.7459 |
| GSM319958 | 3.2227 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 138.64 |
| GSM433289 | 327.4553 |
| GSM433290 | 41.8376 |
| GSM433291 | 449.9949 |
| GSM433292 | 39.6299 |
| GSM433293 | 49.7696 |
| GSM433294 | 89.6364 |
| GSM433295 | 88.7131 |
| GSM475279 | 4.6105 |
| GSM475280 | 3.364 |
| GSM475281 | 8.6308 |
| GSM678422 | 0.4775 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 17446352 | Journal | Science. 2007 May 4;316(5825):744-7. |
|---|---|---|---|
| Title | Developmentally regulated piRNA clusters implicate MILI in transposon control. | ||
| Authors | Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
|---|---|---|---|
| Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
| Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||