Loading...

Detail Information of piRNA: piR-mmu-166

General Information
piRBase Id piR-mmu-166 Accession DQ539904
Organism Mouse Number of methods 3
Sequence AAAGTCAGCCCTCGACACAAGGGTTTGT Number of papers 11
Length 28 Golden piRNA Y
Aliases piR-16; PIR1015;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
32 GSM684625 3 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 19 18922463 small RNA 16.5 dpc testis
60 GSM319956 1 18922463 Mili IP 16.5 dpc testis
61 GSM319957 81 18922463 Miwi2 IP 16.5 dpc testis
62 GSM319958 2 18922463 small RNA 4-6 week ovary
72 GSM179088 10 17446352 Mili IP 10 dpp testis
132 GSM475279 48 20022248 Miwi IP adult testis
133 GSM475280 37 20022248 Mili IP adult testis
217 GSM1653802 285 25582079 MIWI CLIP round spermatids
225 GSM1528807 559 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 407 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 2640 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1028 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 592 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 1497 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 197 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1265 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 163 26115953 small RNA 6 weeks hetero tdrd6 KO testes
239 GSM433293 117 26115953 small RNA 6 weeks homo tdrd6 KO testes
240 GSM433294 382 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
241 GSM433295 373 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 9 25262350 small RNA E16.5 whole testes
247 GSM1318060 16 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 48 20022248 Miwi-IP testis 
346 GSM475280 37 20022248 Mili-IP testis 
347 GSM475281 92 20022248 small RNA testis 
441 GSM1096582 14 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 60 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 43 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 8 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 12 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
3 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:73868004-73868032:+ Atf2 ENSMUST00000112016; Atf2 ENSMUST00000112007; Atf2 ENSMUST00000055833; Atf2 ENSMUST00000090802; Atf2 ENSMUST00000112010; Atf2 ENSMUST00000156455; Atf2 ENSMUST00000112017; Atf2 ENSMUST00000143714; Atf2 ENSMUST00000136958; Atf2 ENSMUST00000141050; Atf2 ENSMUST00000154456; Atf2 ENSMUST00000128531; Atf2 ENSMUST00000138098; Atf2 ENSMUST00000125159;
Location 2 6:87997229-87997257:- Gm5577 ENSMUST00000153372; SINE B2 B3;
Location 3 9:118674952-118674980:- Itga9 ENSMUST00000044165;
piRNA Expression
Sample CPM
GSM179088 55.3192
GSM261957 0
GSM261958 157.8372
GSM261959 7.5096
GSM319953 0
GSM319954 0
GSM319955 11.5294
GSM319956 2.1202
GSM319957 41.7459
GSM319958 3.2227
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 138.64
GSM433289 327.4553
GSM433290 41.8376
GSM433291 449.9949
GSM433292 39.6299
GSM433293 49.7696
GSM433294 89.6364
GSM433295 88.7131
GSM475279 4.6105
GSM475280 3.364
GSM475281 8.6308
GSM678422 0.4775
The Expression of piRNA: piR-mmu-166
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.