Loading...

Detail Information of piRNA: piR-mmu-1633

General Information
piRBase Id piR-mmu-1633 Accession DQ550547
Organism Mouse Number of methods 4
Sequence TGCCTGGGATTAAAGGCATGTCCTGCCATGC Number of papers 11
Length 31 Golden piRNA -
Aliases piR-18659; PIR11658;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 62 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 26 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 39 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 13 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
16 GSM822763 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 15 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 1 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 10 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 6 21602304 small RNA Male germ cell, Round spermatids
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
116 GSM958037 2 22902560 Mili IP Fkbp6 +/-,P10,testis
121 GSM545783 2 20534472 Mov10L1 IP wild type adult testis
217 GSM1653802 8 25582079 MIWI CLIP round spermatids
225 GSM1528807 43 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 90 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 124 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 70 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 7 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 7 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 19 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 9 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 5 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 2 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 10 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 198 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 33 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 52 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 73 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 81 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 168 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 244 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 11:100460783-100460814:-
piRNA Expression
The Expression of piRNA: piR-mmu-1633
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.