Loading...

Detail Information of piRNA: piR-mmu-1619

General Information
piRBase Id piR-mmu-1619 Accession DQ690170
Organism Mouse Number of methods 5
Sequence TGCCTGGAAGACCATATCTCGAATTCAGTC Number of papers 13
Length 30 Golden piRNA -
Aliases piR-18646; piR-105492; PIR11645; PIR198818;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 3 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 532 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 171 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 407 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 532 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 28 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 37 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 1 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 15 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 14 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
73 N/A 1 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
119 GSM958040 1 22902560 Mili IP Tdrd1 -/-,E18,testis
121 GSM545783 2 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 4 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 3 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 2 20059948 Mili IP Tdrd9-/- 14dpp testis
225 GSM1528807 765 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 440 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 678 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 444 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 13 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 27 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 82 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 41 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 6 23523368 small RNA Wild Type 12.5 dpp testes
446 GSM1096601 8 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 11 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 38 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 10 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 56 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 29 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 91 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 10:127695503-127695533:+ Nemp1 ENSMUST00000118728; Nemp1 ENSMUST00000048099;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 1.3377
GSM433288 3.0445
GSM433289 5.906
GSM433290 17.4147
GSM433291 14.5848
GSM433292 30.391
GSM433293 28.9259
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-1619
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.