Loading...

Detail Information of piRNA: piR-mmu-16

General Information
piRBase Id piR-mmu-16 Accession DQ686373
Organism Mouse Number of methods 5
Sequence TGCAAGGTGTCTTATGGGATTTGAAGT Number of papers 9
Length 27 Golden piRNA Y
Aliases piR-17014; piR-101695; PIR10013; PIR195021;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
31 GSM684624 9 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 14 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 32 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 55 22842725 Mili CLIP C57BL/6 adult testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 64 20022248 Mili IP adult testis
225 GSM1528807 187 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 221 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 74 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 83 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 50 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 47 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 40 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 38 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 64 20022248 Mili-IP testis 
347 GSM475281 8 20022248 small RNA testis 
441 GSM1096582 3 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 49 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 55 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 21 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 29 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 4 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 14 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 20 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 20 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 7 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:74641114-74641141:+
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.6213
Sample CPM
GSM400968 0.3908
GSM400969 0
GSM433288 11.7095
GSM433289 10.2808
GSM433290 8.495
GSM433291 13.5176
GSM433292 7.2938
GSM433293 7.6569
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 5.8189
GSM475281 0.7505
GSM678422 0
The Expression of piRNA: piR-mmu-16
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.