Loading...

Detail Information of piRNA: piR-mmu-1599

General Information
piRBase Id piR-mmu-1599 Accession DQ703725
Organism Mouse Number of methods 5
Sequence TGCCTAATTCCGGTGCACAGCTCTGAACT Number of papers 9
Length 29 Golden piRNA Y
Aliases piR-18453; piR-119047; PIR11452; PIR212373;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
132 GSM475279 31 20022248 Miwi IP adult testis
133 GSM475280 2 20022248 Mili IP adult testis
217 GSM1653802 14 25582079 MIWI CLIP round spermatids
225 GSM1528807 44 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 81 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 86 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 42 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 2 26115953 small RNA 18dpp hetero tdrd6 KO testes
236 GSM433290 4 26115953 small RNA 25dpp hetero tdrd6 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 31 20022248 Miwi-IP testis 
346 GSM475280 2 20022248 Mili-IP testis 
347 GSM475281 10 20022248 small RNA testis 
441 GSM1096582 3 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 3 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 5 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 6 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 11 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 10 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 7 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 21 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 6 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 33 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 11 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 18:67057327-67057356:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.4684
GSM433289 0
GSM433290 0.8495
GSM433291 0
GSM433292 1.4588
GSM433293 1.7015
GSM433294 0
GSM433295 0
GSM475279 2.9776
GSM475280 0.1818
GSM475281 0.9381
GSM678422 0
The Expression of piRNA: piR-mmu-1599
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.