Loading...

Detail Information of piRNA: piR-mmu-14936

General Information
piRBase Id piR-mmu-14936 Accession DQ685782
Organism Mouse Number of methods 4
Sequence AAATGTGGTACATTTACACAATGGAGTAC Number of papers 7
Length 29 Golden piRNA -
Aliases piR-101104; PIR194430;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
132 GSM475279 2 20022248 Miwi IP adult testis
133 GSM475280 2 20022248 Mili IP adult testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 2 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 2 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 2 26588211 small RNA Adult testes Asb1 ao36(KO)
240 GSM433294 3 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
241 GSM433295 1 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
345 GSM475279 2 20022248 Miwi-IP testis 
346 GSM475280 2 20022248 Mili-IP testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 1 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 9 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 3 23523368 small RNA Wild Type 14.5 dpp testes
Location in GRCm38
16728 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:135864916-135864945:+ Grin2b ENSMUST00000053880; Grin2b ENSMUST00000111905;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0.8221
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 0.6068
GSM319956 0
GSM319957 0.5154
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.704
GSM433295 0.2378
GSM475279 0.1921
GSM475280 0.1818
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-14936
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.