Loading...

Detail Information of piRNA: piR-mmu-146311

General Information
piRBase Id piR-mmu-146311 Accession N/A
Organism Mouse Number of methods 4
Sequence TGTGTTTGAATGCTTGGCCATAGGGAGTGT Number of papers 7
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 16 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 13 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 9 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
31 GSM684624 15 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
217 GSM1653802 1 25582079 MIWI CLIP round spermatids
225 GSM1528807 6 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 17 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 19 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 15 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 7 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 25 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 20 26115953 small RNA 25dpp hetero tdrd6 KO testes
441 GSM1096582 7 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 15 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 10 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 86 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 28 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 27 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 64 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 51 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 27 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 12 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
3 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 10:25541764-25541794:- Gm29571 ENSMUST00000191547; LINE L1 L1MdA_III;
Location 2 14:73426943-73426973:+ LTR ERVK ETnERV-int;
Location 3 2:143742017-143742047:- Pcsk2 ENSMUST00000028905; LTR ERVL-MaLR ORR1B1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 1.6393
GSM433289 5.4685
GSM433290 4.2475
GSM433291 0
GSM433292 3.4038
GSM433293 2.5523
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-146311
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
4930558J18Rik NR_037999 ENSMUST00000181949.2 NONMMUT000996 cleavage mm9 chr1:57416233-57416253:- n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.