Loading...
piRBase Id | piR-mmu-146311 | Accession | N/A |
---|---|---|---|
Organism | Mouse | Number of methods | 4 |
Sequence | TGTGTTTGAATGCTTGGCCATAGGGAGTGT | Number of papers | 7 |
Length | 30 | Golden piRNA | - |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
11 | GSM822760 | 7 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
12 | GSM822758 | 16 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
13 | GSM822759 | 13 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
14 | GSM822761 | 9 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
31 | GSM684624 | 15 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
51 | GSM610966 | 1 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
217 | GSM1653802 | 1 | 25582079 | MIWI CLIP | round spermatids |
225 | GSM1528807 | 6 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 17 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 19 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 15 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
234 | GSM433288 | 7 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
235 | GSM433289 | 25 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
236 | GSM433290 | 20 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
441 | GSM1096582 | 7 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 15 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 10 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 86 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
447 | GSM1096585 | 28 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
448 | GSM1096602 | 27 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 64 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 51 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 27 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
452 | GSM1096604 | 12 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 10:25541764-25541794:- | Gm29571 ENSMUST00000191547; | LINE L1 L1MdA_III; |
Location 2 | 14:73426943-73426973:+ | LTR ERVK ETnERV-int; | |
Location 3 | 2:143742017-143742047:- | Pcsk2 ENSMUST00000028905; | LTR ERVL-MaLR ORR1B1; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 1.6393 |
GSM433289 | 5.4685 |
GSM433290 | 4.2475 |
GSM433291 | 0 |
GSM433292 | 3.4038 |
GSM433293 | 2.5523 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0 |
GSM475280 | 0 |
GSM475281 | 0 |
GSM678422 | 0 |
No record. |
Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
---|---|---|---|---|---|
4930558J18Rik | NR_037999 ENSMUST00000181949.2 NONMMUT000996 | cleavage | mm9 chr1:57416233-57416253:- | n | N/A |
No record. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
---|---|---|---|
Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |