Loading...

Detail Information of piRNA: piR-mmu-1439

General Information
piRBase Id piR-mmu-1439 Accession DQ550196
Organism Mouse Number of methods 3
Sequence TGCCCAGAGATGGATGGTCGGGAGC Number of papers 12
Length 25 Golden piRNA -
Aliases piR-18308; PIR11307;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 3 21602304 small RNA Male germ cell, Type A spermatogonia
57 GSM319953 9 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 32 18922463 Mili IP 10 dpp Dnmt3L KO testis
72 GSM179088 2 17446352 Mili IP 10 dpp testis
73 N/A 2 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
76 N/A 4 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
78 N/A 1 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
85 N/A 1 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
114 GSM958035 2 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 22 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 35 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 2 22902560 Mili IP Tdrd1 +/-,E18,testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 81 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 72 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 28 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 33 20059948 Mili IP Tdrd9-/- 14dpp testis
132 GSM475279 1 20022248 Miwi IP adult testis
224 GSM1528806 151 26588211 small RNA 10dpp testes
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1 26588211 small RNA Adult testes Asb1 ao34(Het)
234 GSM433288 3 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 2 26115953 small RNA 18dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
441 GSM1096582 4 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 3512 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 30 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 335 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 41 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 547 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 2 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 2 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 6 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:38202291-38202316:- Zbtb49 ENSMUST00000124939; Zbtb49 ENSMUST00000094833; Zbtb49 ENSMUST00000126267; Zbtb49 ENSMUST00000143436; Zbtb49 ENSMUST00000138820; Zbtb49 ENSMUST00000136475;
piRNA Expression
The Expression of piRNA: piR-mmu-1439
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.