Loading...

Detail Information of piRNA: piR-mmu-141907

General Information
piRBase Id piR-mmu-141907 Accession N/A
Organism Mouse Number of methods 4
Sequence TAAAATCCTAGCACTCAGGAGGCTGAAGTA Number of papers 10
Length 30 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 12 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 8 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 21 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 42 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 8 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 6 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 7 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 108 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 2 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 2 18922463 Mili IP 10 dpp Dnmt3L KO testis
116 GSM958037 2 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 7 22902560 Mili IP Fkbp6 -/-,P10,testis
132 GSM475279 96 20022248 Miwi IP adult testis
133 GSM475280 23 20022248 Mili IP adult testis
217 GSM1653802 92 25582079 MIWI CLIP round spermatids
225 GSM1528807 182 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 244 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 157 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 102 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 16 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 4 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 27 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 6 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 96 20022248 Miwi-IP testis 
346 GSM475280 23 20022248 Mili-IP testis 
347 GSM475281 14 20022248 small RNA testis 
441 GSM1096582 3 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 32 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 22 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 42 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 27 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 22 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 12 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 34 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 20 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 15 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 11 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:83355174-83355204:- 1700001L05Rik ENSMUST00000178628;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 1.5076
GSM319954 0.9298
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.932
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.747
GSM433289 0.875
GSM433290 5.7341
GSM433291 2.1344
GSM433292 8.7526
GSM433293 6.8061
GSM433294 0
GSM433295 0
GSM475279 9.221
GSM475280 2.0912
GSM475281 1.3134
GSM678422 0
The Expression of piRNA: piR-mmu-141907
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
Target gene Target trans Mechanism Target site Verified PubMed
NONMMUT002538 cleavage mm9 chr1:132619500-132619520:+ n N/A
Target Network
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.