Loading...

Detail Information of piRNA: piR-mmu-14171

General Information
piRBase Id piR-mmu-14171 Accession DQ685739
Organism Mouse Number of methods 5
Sequence AACACTGAGATGATCTCTTTAACATAAGAGCC Number of papers 9
Length 32 Golden piRNA Y
Aliases piR-101061; PIR194387;
Datasets
Dataset Accession Reads PubMed Method Tissue
6 GSM113695 3 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 116 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 34 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 121 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 72 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 55 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 51 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 4 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 219 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
132 GSM475279 169 20022248 Miwi IP adult testis
133 GSM475280 65 20022248 Mili IP adult testis
217 GSM1653802 234 25582079 MIWI CLIP round spermatids
234 GSM433288 101 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 75 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 290 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 126 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 424 26115953 small RNA 6 weeks hetero tdrd6 KO testes
239 GSM433293 139 26115953 small RNA 6 weeks homo tdrd6 KO testes
444 GSM1096600 3 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 5 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 243 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 129 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 308 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 108 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 258 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 208 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 458 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 2:127692459-127692491:+ Gm14244 ENSMUST00000155688;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 23.6531
GSM433289 16.4056
GSM433290 61.5884
GSM433291 44.8216
GSM433292 103.0864
GSM433293 59.128
GSM433294 0
GSM433295 0
GSM475279 16.2329
GSM475280 5.9098
GSM475281 8.3493
GSM678422 0.1592
The Expression of piRNA: piR-mmu-14171
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.