Loading...

Detail Information of piRNA: piR-mmu-140079

General Information
piRBase Id piR-mmu-140079 Accession N/A
Organism Mouse Number of methods 3
Sequence AACTTCTTAGAGGGACAAGTGGCGTTC Number of papers 12
Length 27 Golden piRNA Y
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 5 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 6 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 18 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 9 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
32 GSM684625 29 22842725 Miwi CLIP C57BL/6 adult testis
50 GSM610965 2 21602304 small RNA Male germ cell, Type A spermatogonia
52 GSM610967 4 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 4 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
60 GSM319956 25 18922463 Mili IP 16.5 dpc testis
61 GSM319957 36 18922463 Miwi2 IP 16.5 dpc testis
72 GSM179088 1 17446352 Mili IP 10 dpp testis
114 GSM958035 32 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 17 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 9 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 3 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 26 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 10 22902560 Mili IP Tdrd1 -/-,E18,testis
120 GSM958041 456 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
133 GSM475280 3 20022248 Mili IP adult testis
217 GSM1653802 15 25582079 MIWI CLIP round spermatids
225 GSM1528807 4 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 6 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 4 26588211 small RNA Adult testes Asb1 ao36(KO)
240 GSM433294 3 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
241 GSM433295 1 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
346 GSM475280 3 20022248 Mili-IP testis 
348 GSM3772906 6 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 11 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 27 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 102 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 10 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 5 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:39847796-39847823:+ CT010467.1 ENSMUST00000198477; Low_complexity Low_complexity A-rich;
Location 2 2:27121279-27121306:+ Fam163b ENSMUST00000151224; Simple_repeat Simple_repeat (TGAA)n;
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 1.6441
GSM261959 0
GSM319953 3.0151
GSM319954 0.4649
GSM319955 0.6068
GSM319956 53.0046
GSM319957 18.5537
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
The Expression of piRNA: piR-mmu-140079
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.