Loading...
piRBase Id | piR-mmu-140079 | Accession | N/A |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | AACTTCTTAGAGGGACAAGTGGCGTTC | Number of papers | 12 |
Length | 27 | Golden piRNA | Y |
Aliases | N/A |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
11 | GSM822760 | 7 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
12 | GSM822758 | 5 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
13 | GSM822759 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
14 | GSM822761 | 6 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
15 | GSM822762 | 18 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
16 | GSM822763 | 9 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
32 | GSM684625 | 29 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
50 | GSM610965 | 2 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
52 | GSM610967 | 4 | 21602304 | small RNA | Male germ cell, Round spermatids |
57 | GSM319953 | 4 | 18922463 | Mili IP | 10 dpp Dnmt3L heterozygotes testis |
58 | GSM319954 | 1 | 18922463 | Mili IP | 10 dpp Dnmt3L KO testis |
59 | GSM319955 | 1 | 18922463 | small RNA | 16.5 dpc testis |
60 | GSM319956 | 25 | 18922463 | Mili IP | 16.5 dpc testis |
61 | GSM319957 | 36 | 18922463 | Miwi2 IP | 16.5 dpc testis |
72 | GSM179088 | 1 | 17446352 | Mili IP | 10 dpp testis |
114 | GSM958035 | 32 | 22902560 | Mili IP | Fkbp6 +/-,P0,testis |
115 | GSM958036 | 17 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
116 | GSM958037 | 9 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
117 | GSM958038 | 3 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
118 | GSM958039 | 26 | 22902560 | Mili IP | Tdrd1 +/-,E18,testis |
119 | GSM958040 | 10 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
120 | GSM958041 | 456 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
133 | GSM475280 | 3 | 20022248 | Mili IP | adult testis |
217 | GSM1653802 | 15 | 25582079 | MIWI CLIP | round spermatids |
225 | GSM1528807 | 4 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 1 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 6 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 4 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
240 | GSM433294 | 3 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
241 | GSM433295 | 1 | 26115953 | small RNA | 18.5dpc homo tdrd1 KO testes |
246 | GSM1318059 | 1 | 25262350 | small RNA | E16.5 whole testes |
346 | GSM475280 | 3 | 20022248 | Mili-IP | testis |
348 | GSM3772906 | 6 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
349 | GSM3772907 | 11 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
350 | GSM3772908 | 27 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
351 | GSM3772909 | 102 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
352 | GSM3772910 | 10 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
353 | GSM3772911 | 5 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 17:39847796-39847823:+ | CT010467.1 ENSMUST00000198477; | Low_complexity Low_complexity A-rich; |
Location 2 | 2:27121279-27121306:+ | Fam163b ENSMUST00000151224; | Simple_repeat Simple_repeat (TGAA)n; |
Sample | CPM |
---|---|
GSM179088 | 5.5319 |
GSM261957 | 0 |
GSM261958 | 1.6441 |
GSM261959 | 0 |
GSM319953 | 3.0151 |
GSM319954 | 0.4649 |
GSM319955 | 0.6068 |
GSM319956 | 53.0046 |
GSM319957 | 18.5537 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 0 |
GSM433289 | 0 |
GSM433290 | 0 |
GSM433291 | 0 |
GSM433292 | 0 |
GSM433293 | 0 |
GSM433294 | 0.704 |
GSM433295 | 0.2378 |
GSM475279 | 0 |
GSM475280 | 0.2728 |
GSM475281 | 0 |
GSM678422 | 0.1592 |
No record. |
No record. |
No record. |
No record. |
PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
---|---|---|---|
Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. |
PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
---|---|---|---|
Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 17446352 | Journal | Science. 2007 May 4;316(5825):744-7. |
---|---|---|---|
Title | Developmentally regulated piRNA clusters implicate MILI in transposon control. | ||
Authors | Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
---|---|---|---|
Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
---|---|---|---|
Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. |
PubMed | 32674113 | Journal | Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5. |
---|---|---|---|
Title | SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation. | ||
Authors | Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D. |