Loading...

Detail Information of piRNA: piR-mmu-1400

General Information
piRBase Id piR-mmu-1400 Accession DQ550160
Organism Mouse Number of methods 4
Sequence TGCCATTTATGAACCTAATTGTCTTGGACATG Number of papers 8
Length 32 Golden piRNA -
Aliases piR-18272; PIR11271;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 21 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 9 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 10 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 58 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 13 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 15 22842725 Miwi CLIP C57BL/6 adult testis
58 GSM319954 1 18922463 Mili IP 10 dpp Dnmt3L KO testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 1 20022248 Mili IP adult testis
217 GSM1653802 3 25582079 MIWI CLIP round spermatids
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
446 GSM1096601 12 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 5 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 4 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 4 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 3 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:91558654-91558686:+ Asb1 ENSMUST00000027538;
piRNA Expression
The Expression of piRNA: piR-mmu-1400
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.