Loading...

Detail Information of piRNA: piR-mmu-139975

General Information
piRBase Id piR-mmu-139975 Accession N/A
Organism Mouse Number of methods 4
Sequence AAAGACTAATCGAACCATCTAGTAGCTGGT Number of papers 8
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 7 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 9 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 12 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 17 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 6 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
51 GSM610966 23 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 56 21602304 small RNA Male germ cell, Round spermatids
132 GSM475279 5 20022248 Miwi IP adult testis
133 GSM475280 1 20022248 Mili IP adult testis
217 GSM1653802 2 25582079 MIWI CLIP round spermatids
225 GSM1528807 45 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 22 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 56 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 78 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 1 26115953 small RNA 18dpp hetero tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 3 26115953 small RNA 6 weeks hetero tdrd6 KO testes
239 GSM433293 1 26115953 small RNA 6 weeks homo tdrd6 KO testes
241 GSM433295 1 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 27 25262350 small RNA E16.5 whole testes
247 GSM1318060 25 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 5 20022248 Miwi-IP testis 
346 GSM475280 1 20022248 Mili-IP testis 
347 GSM475281 7 20022248 small RNA testis 
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
Location in GRCm38
12 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 3:37481594-37481624:+ Spata5 ENSMUST00000108112; Spata5 ENSMUST00000029277; Spata5 ENSMUST00000198968; Spata5 ENSMUST00000130674;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0.2342
GSM433289 0
GSM433290 0.6371
GSM433291 0.3557
GSM433292 0.7294
GSM433293 0.4254
GSM433294 0
GSM433295 0.2378
GSM475279 0.4803
GSM475280 0.0909
GSM475281 0.6567
GSM678422 0.0531
The Expression of piRNA: piR-mmu-139975
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.