Loading...

Detail Information of piRNA: piR-mmu-1372

General Information
piRBase Id piR-mmu-1372 Accession DQ550135
Organism Mouse Number of methods 2
Sequence TGCCATTATAAATTTCACCTCTCCTGTGC Number of papers 6
Length 29 Golden piRNA -
Aliases piR-18247; PIR11246;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
61 GSM319957 2 18922463 Miwi2 IP 16.5 dpc testis
83 N/A 1 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 1 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 1 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 3 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 5 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 5 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
228 GSM1528810 3 26588211 small RNA Adult testes Asb1 ao36(KO)
237 GSM433291 1 26115953 small RNA 25dpp homo tdrd6 KO testes
443 GSM1096583 5 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 4 23523368 small RNA Wild Type 14.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
697 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:76969382-76969411:+
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 1.0308
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0.3557
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0.2378
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-1372
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.