Loading...

Detail Information of piRNA: piR-mmu-13534

General Information
piRBase Id piR-mmu-13534 Accession N/A
Organism Mouse Number of methods 4
Sequence TGAATTAGATTAGAAGAACAGTTGGC Number of papers 14
Length 26 Golden piRNA Y
Aliases PIR192148;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 18 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
17 GSM822764 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
35 GSM684620 3 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 65 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 10 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 302 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 234 21602304 small RNA Male germ cell, Round spermatids
63 GSM319959 3 18922463 small RNA 2 dpp testis
64 GSM319960 1 18922463 small RNA 10 dpp testis
68 GSM509277 5 20439430 small RNA Mili-/- E16.5 testis
70 GSM509279 3 20439430 small RNA MVH-/- E16.5 testis
78 N/A 1 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
80 N/A 23 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
116 GSM958037 25 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 32 22902560 Mili IP Fkbp6 -/-,P10,testis
118 GSM958039 2 22902560 Mili IP Tdrd1 +/-,E18,testis
119 GSM958040 6 22902560 Mili IP Tdrd1 -/-,E18,testis
121 GSM545783 387 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 262 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 262 20059948 Mili IP Tdrd9+/- 14dpp testis
130 GSM466730 31 20059948 Mili IP Tdrd9-/- 14dpp testis
131 GSM466731 26 20059948 Mili IP Tdrd9-/- 14dpp testis
132 GSM475279 14 20022248 Miwi IP adult testis
133 GSM475280 702 20022248 Mili IP adult testis
224 GSM1528806 14 26588211 small RNA 10dpp testes
225 GSM1528807 73 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 92 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 44 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 50 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 11 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 8 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 2 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 14 20022248 Miwi-IP testis 
346 GSM475280 702 20022248 Mili-IP testis 
347 GSM475281 65 20022248 small RNA testis 
441 GSM1096582 31 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 31 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 296 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 154 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 424 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 25 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 118 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 43 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 169 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 36 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 95 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 15:83354667-83354693:- 1700001L05Rik ENSMUST00000178628; SINE B4 ID_B1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 2.049
GSM319960 0.4991
GSM319961 0
GSM400967 263.4459
Sample CPM
GSM400968 561.9508
GSM400969 24.4122
GSM433288 2.5761
GSM433289 1.7499
GSM433290 0.6371
GSM433291 0.7115
GSM433292 0.7294
GSM433293 0.4254
GSM433294 0
GSM433295 0
GSM475279 1.3447
GSM475280 63.826
GSM475281 6.0978
GSM678422 0
The Expression of piRNA: piR-mmu-13534
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.