Loading...

Detail Information of piRNA: piR-mmu-1352

General Information
piRBase Id piR-mmu-1352 Accession DQ550117
Organism Mouse Number of methods 3
Sequence TGCCATGTCTACGTCCGGAGCGACAGTC Number of papers 4
Length 28 Golden piRNA -
Aliases piR-18229; PIR11228;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
117 GSM958038 3 22902560 Mili IP Fkbp6 -/-,P10,testis
445 GSM1096584 4 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 16 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 11:5961195-5961223:+ Ykt6 ENSMUST00000002818; Ykt6 ENSMUST00000143834; LTR ERV1 RLTR4_Mm;
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.