Loading...

Detail Information of piRNA: piR-mmu-13454

General Information
piRBase Id piR-mmu-13454 Accession AB251322
Organism Mouse Number of methods 5
Sequence TGATTAGATGAATATGGTGATGTGGC Number of papers 19
Length 26 Golden piRNA Y
Aliases piR-129545; PIR192075; PIR222871; gsRNA352;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
6 GSM113695 7 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
10 N/A N/A 16766680 small RNA testis
11 GSM822760 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 10 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 6 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 91 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 10 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 11 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 1563 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 1250 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 517 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 1146 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 29 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 77 21602304 small RNA Male germ cell, Round spermatids
63 GSM319959 1 18922463 small RNA 2 dpp testis
64 GSM319960 1 18922463 small RNA 10 dpp testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 1 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 13 20439430 small RNA Mili-/- E16.5 testis
72 GSM179088 1 17446352 Mili IP 10 dpp testis
80 N/A 4 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
116 GSM958037 4 22902560 Mili IP Fkbp6 +/-,P10,testis
121 GSM545783 430 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 733 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 796 20059948 Mili IP Tdrd9+/- 14dpp testis
131 GSM466731 1 20059948 Mili IP Tdrd9-/- 14dpp testis
132 GSM475279 170 20022248 Miwi IP adult testis
133 GSM475280 7486 20022248 Mili IP adult testis
217 GSM1653802 105 25582079 MIWI CLIP round spermatids
224 GSM1528806 81 26588211 small RNA 10dpp testes
225 GSM1528807 525 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 435 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 550 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 544 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 616 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 272 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 336 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 175 26115953 small RNA 25dpp homo tdrd6 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 170 20022248 Miwi-IP testis 
346 GSM475280 7486 20022248 Mili-IP testis 
347 GSM475281 467 20022248 small RNA testis 
441 GSM1096582 179 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 18 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 805 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 1286 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 411 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 2425 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 128 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 364 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 420 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 945 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 162 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 256 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27356494-27356520:+ Gm49794 ENSMUST00000232133; SINE B2 B2_Mm2;
piRNA Expression
Sample CPM
GSM179088 5.5319
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0.683
GSM319960 0.4991
GSM319961 0
GSM400967 282.3966
Sample CPM
GSM400968 149.6712
GSM400969 34.779
GSM433288 144.2605
GSM433289 59.4975
GSM433290 71.3576
GSM433291 62.2523
GSM433292 35.4967
GSM433293 41.262
GSM433294 0
GSM433295 0
GSM475279 16.3289
GSM475280 680.6287
GSM475281 43.8105
GSM678422 0.1061
The Expression of piRNA: piR-mmu-13454
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 16766680 Journal Genes Dev. 2006 Jul 1;20(13):1709-14.
Title A novel class of small RNAs in mouse spermatogenic cells.
Authors Grivna ST, Beyret E, Wang Z, Lin H.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.