Loading...

Detail Information of piRNA: piR-mmu-1333

General Information
piRBase Id piR-mmu-1333 Accession DQ701085
Organism Mouse Number of methods 5
Sequence TGCCATGATGATTTGAAGCAGCACAAGT Number of papers 12
Length 28 Golden piRNA Y
Aliases piR-18182; piR-116407; PIR11181; PIR209733;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 6 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 1 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 12 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 27 22842725 Miwi CLIP C57BL/6 adult testis
51 GSM610966 3 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 23 21602304 small RNA Male germ cell, Round spermatids
121 GSM545783 5 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 4 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 2 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 149 20022248 Miwi IP adult testis
133 GSM475280 811 20022248 Mili IP adult testis
217 GSM1653802 7 25582079 MIWI CLIP round spermatids
224 GSM1528806 10 26588211 small RNA 10dpp testes
225 GSM1528807 545 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 456 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 579 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 731 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 337 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 871 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 569 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 109 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 149 20022248 Miwi-IP testis 
346 GSM475280 811 20022248 Mili-IP testis 
347 GSM475281 105 20022248 small RNA testis 
441 GSM1096582 26 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 71 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 691 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 461 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 802 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1411 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 70 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 155 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 146 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 210 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 49 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 57 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27348212-27348240:+
piRNA Expression
Sample CPM
GSM400968 10.942
GSM400969 0.6688
GSM433288 78.9217
GSM433289 190.5234
GSM433290 120.8407
GSM433291 38.7743
GSM433292 79.5029
GSM433293 71.0386
GSM433294 0
GSM433295 0
GSM475279 14.3118
GSM475280 73.7363
GSM475281 9.8503
GSM678422 0
The Expression of piRNA: piR-mmu-1333
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.