Loading...
| piRBase Id | piR-mmu-13 | Accession | DQ548899 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 2 |
| Sequence | TGCAAGGTGGATGATATACCCCAACAGGCC | Number of papers | 2 |
| Length | 30 | Golden piRNA | - |
| Aliases | piR-17011; PIR10010; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 448 | GSM1096602 | 1 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 7:73787161-73787191:- | Gm10619 ENSMUST00000186073; |
| No record. |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||