Loading...

Detail Information of piRNA: piR-mmu-129007

General Information
piRBase Id piR-mmu-129007 Accession N/A
Organism Mouse Number of methods 2
Sequence AAGAACGAAAGTCGGAGGTTCGAAGACGAT Number of papers 11
Length 30 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 9 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 28 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 5 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
15 GSM822762 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 27 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 8 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 4 21602304 small RNA Male germ cell, Round spermatids
73 N/A 9 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 4 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 8 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
76 N/A 15 22020280 Mili IP Miwi2DAH_2 E16.5 fetal testis
77 N/A 1 22020280 Mili IP Miwi2+/-_1 E16.5 fetal testis
81 N/A 21 22020280 Mili IP wild_type_1 E16.5 fetal testis
82 N/A 7 22020280 Mili IP wild_type_2 E16.5 fetal testis
83 N/A 4 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 2 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
85 N/A 21 22020280 Miwi2 IP Miwi2DAH_1 E16.5 fetal testis
86 N/A 10 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
87 N/A 23 22020280 Miwi2 IP wild_type_1 E16.5 fetal testis
88 N/A 8 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
116 GSM958037 5 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 4 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 3 20022248 Miwi IP adult testis
133 GSM475280 2 20022248 Mili IP adult testis
225 GSM1528807 1 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 3 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 3 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 6 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 1 26115953 small RNA 18dpp homo tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
241 GSM433295 3 26115953 small RNA 18.5dpc homo tdrd1 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 3 20022248 Miwi-IP testis 
346 GSM475280 2 20022248 Mili-IP testis 
348 GSM3772906 3 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 4 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 8 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 32 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 5 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 1 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 9 23523368 small RNA Wild Type 12.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:3201474-3201504:+ rRNA rRNA SSU-rRNA_Hsa;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 3.2883
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0.3107
Sample CPM
GSM400968 0
GSM400969 7.6915
GSM433288 0
GSM433289 0.2187
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.2347
GSM433295 0.7135
GSM475279 0.2882
GSM475280 0.1818
GSM475281 0
GSM678422 0.8489
The Expression of piRNA: piR-mmu-129007
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.