Loading...

Detail Information of piRNA: piR-mmu-129

General Information
piRBase Id piR-mmu-129 Accession DQ549005
Organism Mouse Number of methods 4
Sequence TGCAATGTCACTGGGTCCTTGAGATGT Number of papers 9
Length 27 Golden piRNA -
Aliases piR-17117; PIR10116;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
14 GSM822761 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 19 22842725 Miwi CLIP C57BL/6 adult testis
36 GSM684621 162 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 149 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 99 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
132 GSM475279 10 20022248 Miwi IP adult testis
133 GSM475280 68 20022248 Mili IP adult testis
225 GSM1528807 48 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 67 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 76 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 53 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 27 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 64 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 48 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 10 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 10 20022248 Miwi-IP testis 
346 GSM475280 68 20022248 Mili-IP testis 
347 GSM475281 56 20022248 small RNA testis 
441 GSM1096582 27 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 116 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 238 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 233 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 371 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 25 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 80 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 83 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 158 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 39 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 61 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
3 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:113356657-113356684:+
Location 2 5:114817950-114817977:- 1500011B03Rik ENSMUST00000140374;
Location 3 5:114843417-114843444:- Simple_repeat Simple_repeat (CCTT)n;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 6.3231
GSM433289 13.9994
GSM433290 10.1939
GSM433291 3.5573
GSM433292 12.1564
GSM433293 5.53
GSM433294 0
GSM433295 0
GSM475279 0.9605
GSM475280 6.1826
GSM475281 5.2535
GSM678422 0
The Expression of piRNA: piR-mmu-129
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.