Loading...

Detail Information of piRNA: piR-mmu-12865

General Information
piRBase Id piR-mmu-12865 Accession N/A
Organism Mouse Number of methods 3
Sequence TGGTAGAAAAGGAAAGAGATTCCTCC Number of papers 8
Length 26 Golden piRNA Y
Aliases PIR191541;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
51 GSM610966 9 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
63 GSM319959 1 18922463 small RNA 2 dpp testis
121 GSM545783 1 20534472 Mov10L1 IP wild type adult testis
132 GSM475279 2 20022248 Miwi IP adult testis
133 GSM475280 67 20022248 Mili IP adult testis
225 GSM1528807 65 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 61 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 38 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 87 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 19 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 59 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 25 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 10 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 2 20022248 Miwi-IP testis 
346 GSM475280 67 20022248 Mili-IP testis 
347 GSM475281 13 20022248 small RNA testis 
441 GSM1096582 22 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 379 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 183 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 240 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 141 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 34 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 55 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 69 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 86 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 40 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 31 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27344386-27344412:+ Gm10505 ENSMUST00000232285; Gm10505 ENSMUST00000232497; Gm10505 ENSMUST00000231770; Gm10505 ENSMUST00000231262; Gm10505 ENSMUST00000232363; Gm10505 ENSMUST00000231707; Gm10505 ENSMUST00000232070; Gm10505 ENSMUST00000231462; Gm10505 ENSMUST00000232675; Gm10505 ENSMUST00000231336; Gm10505 ENSMUST00000232171; Gm10505 ENSMUST00000231637; Gm10505 ENSMUST00000232125; Gm10505 ENSMUST00000231456; Gm10505 ENSMUST00000231346; Gm10505 ENSMUST00000231771; Gm10505 ENSMUST00000231613; Gm10505 ENSMUST00000231631; Gm10505 ENSMUST00000232337; Gm10505 ENSMUST00000231411; Gm10505 ENSMUST00000151398; Gm10505 ENSMUST00000231774; Gm10505 ENSMUST00000231649; Gm10505 ENSMUST00000232349; Gm10505 ENSMUST00000231950;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0.683
GSM319960 0
GSM319961 0
GSM400967 0.6213
Sample CPM
GSM400968 1.1724
GSM400969 0
GSM433288 4.4496
GSM433289 12.9057
GSM433290 5.3093
GSM433291 3.5573
GSM433292 3.6469
GSM433293 2.5523
GSM433294 0
GSM433295 0
GSM475279 0.1921
GSM475280 6.0917
GSM475281 1.2196
GSM678422 0
The Expression of piRNA: piR-mmu-12865
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.