Loading...

Detail Information of piRNA: piR-mmu-124864

General Information
piRBase Id piR-mmu-124864 Accession N/A
Organism Mouse Number of methods 3
Sequence AAGAACGAAAGTCGGAGGTTCGAAGACGATCA Number of papers 5
Length 32 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 10 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 8 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 3 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
15 GSM822762 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
241 GSM433295 1 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
443 GSM1096583 18 23523368 small RNA Wild Type 12.5 dpp testes
446 GSM1096601 61 23523368 oxidized small RNA Wild Type 14.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:3201474-3201506:+ rRNA rRNA SSU-rRNA_Hsa;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 2.4662
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0.2347
GSM433295 0.2378
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0.0531
The Expression of piRNA: piR-mmu-124864
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.