Loading...
| piRBase Id | piR-mmu-12323 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TAGTAGTTTCCTGAGGTGATGAAGGAA | Number of papers | 11 |
| Length | 27 | Golden piRNA | - |
| Aliases | PIR191029; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 5 | N/A | N/A | 16751777 | MILI IP | testis |
| 33 | GSM684626 | 1 | 22842725 | Miwi CLIP | C57BL/6 adult testis |
| 35 | GSM684620 | 41 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 36 | GSM684621 | 100 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 37 | GSM684622 | 16 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 38 | GSM684623 | 58 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 51 | GSM610966 | 23 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 6 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 60 | GSM319956 | 1 | 18922463 | Mili IP | 16.5 dpc testis |
| 121 | GSM545783 | 1 | 20534472 | Mov10L1 IP | wild type adult testis |
| 129 | GSM466729 | 2 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 133 | GSM475280 | 2 | 20022248 | Mili IP | adult testis |
| 217 | GSM1653802 | 1 | 25582079 | MIWI CLIP | round spermatids |
| 225 | GSM1528807 | 6 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 12 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 27 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 22 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 54 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 29 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 47 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 19 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 346 | GSM475280 | 2 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 7 | 20022248 | small RNA | testis |
| 441 | GSM1096582 | 37 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 2545 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 105 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 1326 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 150 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 79 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 5 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 80 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 12 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 48 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 5 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 17:27333961-27333988:+ | Gm10505 ENSMUST00000232285; Gm10505 ENSMUST00000232497; Gm10505 ENSMUST00000231770; Gm10505 ENSMUST00000231262; Gm10505 ENSMUST00000232363; Gm10505 ENSMUST00000231707; Gm10505 ENSMUST00000232070; Gm10505 ENSMUST00000231462; Gm10505 ENSMUST00000232675; Gm10505 ENSMUST00000231336; Gm10505 ENSMUST00000232171; Gm10505 ENSMUST00000231637; Gm10505 ENSMUST00000232125; Gm10505 ENSMUST00000231456; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 2.1202 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0.3344 |
| GSM433288 | 12.6462 |
| GSM433289 | 6.3435 |
| GSM433290 | 9.9816 |
| GSM433291 | 6.7588 |
| GSM433292 | 5.8351 |
| GSM433293 | 8.5076 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0.1818 |
| GSM475281 | 0.6567 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751777 | Journal | Nature. 2006 Jul 13;442(7099):203-7. |
|---|---|---|---|
| Title | A novel class of small RNAs bind to MILI protein in mouse testes | ||
| Authors | Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
|---|---|---|---|
| Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
| Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. | ||
| PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
|---|---|---|---|
| Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
| Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||