Loading...

Detail Information of piRNA: piR-mmu-12105

General Information
piRBase Id piR-mmu-12105 Accession DQ708329
Organism Mouse Number of methods 5
Sequence TGAGAAATGCCTAGACTTCAGAAGCA Number of papers 15
Length 26 Golden piRNA Y
Aliases piR-123651; PIR190890; PIR216977;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
14 GSM822761 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
31 GSM684624 7 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 6 22842725 Miwi CLIP C57BL/6 adult testis
36 GSM684621 132 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 354 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 245 21602304 small RNA Male germ cell, Round spermatids
63 GSM319959 1 18922463 small RNA 2 dpp testis
65 GSM319961 1 18922463 small RNA 10 dpp MILI KO testis
66 GSM509275 2 20439430 small RNA MitoPLD+/+ E16.5 testis
78 N/A 2 22020280 Mili IP Miwi2+/-_2 E16.5 fetal testis
80 N/A 1 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
121 GSM545783 26 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 41 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 38 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 37 20022248 Miwi IP adult testis
133 GSM475280 213 20022248 Mili IP adult testis
217 GSM1653802 1 25582079 MIWI CLIP round spermatids
225 GSM1528807 337 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 424 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 381 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 230 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 39 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 81 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 46 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 12 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 37 20022248 Miwi-IP testis 
346 GSM475280 213 20022248 Mili-IP testis 
347 GSM475281 62 20022248 small RNA testis 
441 GSM1096582 8 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 258 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 122 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 276 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 424 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 20 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 35 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 45 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 79 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 29 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 26 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27331132-27331158:+ Gm10505 ENSMUST00000232285; Gm10505 ENSMUST00000232497; Gm10505 ENSMUST00000231770; Gm10505 ENSMUST00000231262; Gm10505 ENSMUST00000232363; Gm10505 ENSMUST00000231707; Gm10505 ENSMUST00000232070; Gm10505 ENSMUST00000231462; Gm10505 ENSMUST00000232675; Gm10505 ENSMUST00000231336; Gm10505 ENSMUST00000232171; Gm10505 ENSMUST00000231637; Gm10505 ENSMUST00000232125; Simple_repeat Simple_repeat (GTGTCC)n;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0.683
GSM319960 0
GSM319961 2.0518
GSM400967 13.048
Sample CPM
GSM400968 46.5036
GSM400969 1.0032
GSM433288 9.1334
GSM433289 17.718
GSM433290 9.7692
GSM433291 4.2687
GSM433292 8.2664
GSM433293 7.6569
GSM433294 0
GSM433295 0
GSM475279 3.5539
GSM475280 19.366
GSM475281 5.8164
GSM678422 0.0531
The Expression of piRNA: piR-mmu-12105
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.