Loading...
| piRBase Id | piR-mmu-1201 | Accession | DQ549950 |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGCCAGGAGAAGCCTCTGGACATGCCT | Number of papers | 7 |
| Length | 27 | Golden piRNA | - |
| Aliases | piR-18062; PIR11061; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 4 | N/A | N/A | 16751776 | small RNA | testis |
| 35 | GSM684620 | 27 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 51 | GSM610966 | 32 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 3 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 225 | GSM1528807 | 25 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 18 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 19 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 20 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 10 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 23 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 16 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 4 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 246 | GSM1318059 | 1 | 25262350 | small RNA | E16.5 whole testes |
| 441 | GSM1096582 | 7 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 25 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 2 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 94 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 17 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 4 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 2 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 46 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 10 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 18 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 2 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 17:27343361-27343388:+ | Gm10505 ENSMUST00000232285; Gm10505 ENSMUST00000232497; Gm10505 ENSMUST00000231770; Gm10505 ENSMUST00000231262; Gm10505 ENSMUST00000232363; Gm10505 ENSMUST00000231707; Gm10505 ENSMUST00000232070; Gm10505 ENSMUST00000231462; Gm10505 ENSMUST00000232675; Gm10505 ENSMUST00000231336; Gm10505 ENSMUST00000232171; Gm10505 ENSMUST00000231637; Gm10505 ENSMUST00000232125; Gm10505 ENSMUST00000231456; Gm10505 ENSMUST00000231346; Gm10505 ENSMUST00000231771; Gm10505 ENSMUST00000231613; Gm10505 ENSMUST00000231631; Gm10505 ENSMUST00000232337; Gm10505 ENSMUST00000231411; Gm10505 ENSMUST00000151398; Gm10505 ENSMUST00000231774; Gm10505 ENSMUST00000231649; Gm10505 ENSMUST00000232349; Gm10505 ENSMUST00000231950; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0.3908 |
| GSM400969 | 0 |
| GSM433288 | 2.3419 |
| GSM433289 | 5.031 |
| GSM433290 | 3.398 |
| GSM433291 | 1.4229 |
| GSM433292 | 2.4313 |
| GSM433293 | 2.5523 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 0 |
| GSM475280 | 0 |
| GSM475281 | 0 |
| GSM678422 | 0 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
|---|---|---|---|
| Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
| Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
|---|---|---|---|
| Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
| Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||