Loading...

Detail Information of piRNA: piR-mmu-1201

General Information
piRBase Id piR-mmu-1201 Accession DQ549950
Organism Mouse Number of methods 3
Sequence TGCCAGGAGAAGCCTCTGGACATGCCT Number of papers 7
Length 27 Golden piRNA -
Aliases piR-18062; PIR11061;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
35 GSM684620 27 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 32 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 3 21602304 small RNA Male germ cell, Round spermatids
225 GSM1528807 25 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 18 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 19 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 20 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 10 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 23 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 16 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 4 26115953 small RNA 25dpp homo tdrd6 KO testes
246 GSM1318059 1 25262350 small RNA E16.5 whole testes
441 GSM1096582 7 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 25 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 2 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 94 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 17 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 4 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 2 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 46 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 10 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 18 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 2 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27343361-27343388:+ Gm10505 ENSMUST00000232285; Gm10505 ENSMUST00000232497; Gm10505 ENSMUST00000231770; Gm10505 ENSMUST00000231262; Gm10505 ENSMUST00000232363; Gm10505 ENSMUST00000231707; Gm10505 ENSMUST00000232070; Gm10505 ENSMUST00000231462; Gm10505 ENSMUST00000232675; Gm10505 ENSMUST00000231336; Gm10505 ENSMUST00000232171; Gm10505 ENSMUST00000231637; Gm10505 ENSMUST00000232125; Gm10505 ENSMUST00000231456; Gm10505 ENSMUST00000231346; Gm10505 ENSMUST00000231771; Gm10505 ENSMUST00000231613; Gm10505 ENSMUST00000231631; Gm10505 ENSMUST00000232337; Gm10505 ENSMUST00000231411; Gm10505 ENSMUST00000151398; Gm10505 ENSMUST00000231774; Gm10505 ENSMUST00000231649; Gm10505 ENSMUST00000232349; Gm10505 ENSMUST00000231950;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0.3908
GSM400969 0
GSM433288 2.3419
GSM433289 5.031
GSM433290 3.398
GSM433291 1.4229
GSM433292 2.4313
GSM433293 2.5523
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-1201
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.