Loading...

Detail Information of piRNA: piR-mmu-118

General Information
piRBase Id piR-mmu-118 Accession DQ548995
Organism Mouse Number of methods 4
Sequence TGCAATGCTGGCATATGGACTGTCTATTC Number of papers 9
Length 29 Golden piRNA -
Aliases piR-17107; PIR10106;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 157 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 154 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 186 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 25 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 25 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 237 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 21 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 32 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 6 22842725 Miwi CLIP C57BL/6 adult testis
36 GSM684621 84 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 43 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 3 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 38 21602304 small RNA Male germ cell, Round spermatids
121 GSM545783 10 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 2 20059948 Mili IP Tdrd9+/- 14dpp testis
225 GSM1528807 181 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 82 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 90 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 42 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 23 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 19 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 60 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 27 26115953 small RNA 25dpp homo tdrd6 KO testes
441 GSM1096582 3 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 3 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 7 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 33 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 20 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 57 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 36 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 119 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 9:67696528-67696557:- LINE CR1 L3;
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0.3344
GSM433288 5.3864
GSM433289 4.1561
GSM433290 12.7424
GSM433291 9.6046
GSM433292 17.2621
GSM433293 7.6569
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-118
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.