Loading...

Detail Information of piRNA: piR-mmu-115509

General Information
piRBase Id piR-mmu-115509 Accession N/A
Organism Mouse Number of methods 3
Sequence AAAGACTAATCGAACCATCTAGTAGCTGG Number of papers 8
Length 29 Golden piRNA -
Aliases N/A
Datasets
Dataset Accession Reads PubMed Method Tissue
11 GSM822760 13 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 9 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 14 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 18 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 9 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 5 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 2 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 9 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 4 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 20 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
225 GSM1528807 53 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 21 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 35 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 83 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 3 26115953 small RNA 18dpp homo tdrd6 KO testes
241 GSM433295 2 26115953 small RNA 18.5dpc homo tdrd1 KO testes
246 GSM1318059 23 25262350 small RNA E16.5 whole testes
247 GSM1318060 20 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
444 GSM1096600 11 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 2 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1 23523368 oxidized small RNA Wild Type 14.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
12 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 19:51142738-51142767:- Simple_repeat Simple_repeat (TCTCCC)n;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0.6562
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0
GSM433294 0
GSM433295 0.4757
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-115509
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.