Loading...

Detail Information of piRNA: piR-mmu-1155

General Information
piRBase Id piR-mmu-1155 Accession DQ539991
Organism Mouse Number of methods 3
Sequence ACAGAGTGAGTTCCAGGACAGCCAGGT Number of papers 9
Length 27 Golden piRNA -
Aliases piR-103; PIR1102;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
16 GSM822763 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 5 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 6 18922463 Mili IP 10 dpp Dnmt3L KO testis
71 GSM509280 73 20439430 small RNA MitoPLD-/- 10 dpp testis
116 GSM958037 41 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 12 22902560 Mili IP Fkbp6 -/-,P10,testis
224 GSM1528806 19 26588211 small RNA 10dpp testes
236 GSM433290 1 26115953 small RNA 25dpp hetero tdrd6 KO testes
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 83 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 17 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 79 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 20 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 177 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
367 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:14051353-14051380:- Sema3e ENSMUST00000073957; Sema3e ENSMUST00000130116;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
The Expression of piRNA: piR-mmu-1155
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.