Loading...

Detail Information of piRNA: piR-mmu-1150

General Information
piRBase Id piR-mmu-1150 Accession DQ549904
Organism Mouse Number of methods 3
Sequence TGCCAGATCAAATAAGTGCCCTTAACTGT Number of papers 6
Length 29 Golden piRNA -
Aliases piR-18016; PIR11015;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
58 GSM319954 3 18922463 Mili IP 10 dpp Dnmt3L KO testis
72 GSM179088 2 17446352 Mili IP 10 dpp testis
132 GSM475279 1 20022248 Miwi IP adult testis
226 GSM1528808 1 26588211 small RNA Adult testes Asb1 ao32(KO)
345 GSM475279 1 20022248 Miwi-IP testis 
443 GSM1096583 3 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 2 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 2 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 59 23523368 oxidized small RNA Wild Type 14.5 dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 11:94540952-94540981:- Rsad1 ENSMUST00000132274; Rsad1 ENSMUST00000040487;
piRNA Expression
Sample CPM
GSM179088 11.0638
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 1.3947
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 0
GSM433290 0
GSM433291 0
GSM433292 0
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-1150
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 17446352 Journal Science. 2007 May 4;316(5825):744-7.
Title Developmentally regulated piRNA clusters implicate MILI in transposon control.
Authors Aravin AA, Sachidanandam R, Girard A, Fejes-Toth K, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.