Loading...

Detail Information of piRNA: piR-mmu-1145

General Information
piRBase Id piR-mmu-1145 Accession DQ686690
Organism Mouse Number of methods 5
Sequence TGCCAGAGTGTTGACATTAGAGTTCATCT Number of papers 16
Length 29 Golden piRNA -
Aliases piR-18011; piR-102012; PIR11010; PIR195338;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 7 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 42 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 32 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 18 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 29 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 30 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 204 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 31 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 7 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 8 22842725 Miwi CLIP C57BL/6 adult testis
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 15 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 403 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 2 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
58 GSM319954 3 18922463 Mili IP 10 dpp Dnmt3L KO testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
66 GSM509275 1 20439430 small RNA MitoPLD+/+ E16.5 testis
73 N/A 5 22020280 Mili IP Mili_MiliDAH_1 E16.5 fetal testis
74 N/A 1 22020280 Mili IP Mili_MiliDAH_2 E16.5 fetal testis
75 N/A 1 22020280 Mili IP Miwi2DAH_1 E16.5 fetal testis
79 N/A 1 22020280 Mili IP Miwi2-/-_1 E16.5 fetal testis
116 GSM958037 1 22902560 Mili IP Fkbp6 +/-,P10,testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 5 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 51 20022248 Miwi IP adult testis
133 GSM475280 31 20022248 Mili IP adult testis
217 GSM1653802 2 25582079 MIWI CLIP round spermatids
225 GSM1528807 352 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 280 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 543 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 581 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 107 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 107 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 235 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 128 26115953 small RNA 25dpp homo tdrd6 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 51 20022248 Miwi-IP testis 
346 GSM475280 31 20022248 Mili-IP testis 
347 GSM475281 36 20022248 small RNA testis 
441 GSM1096582 10 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 20 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 18 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 32 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 43 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 31 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 7 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 45 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 15 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 45 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 11 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:128189155-128189184:- Gm10010 ENSMUST00000071101;
piRNA Expression
Sample CPM
GSM400968 0.3908
GSM400969 0.6688
GSM433288 25.0582
GSM433289 23.4053
GSM433290 49.9078
GSM433291 45.5331
GSM433292 82.6636
GSM433293 59.9787
GSM433294 0
GSM433295 0
GSM475279 4.8987
GSM475280 2.8185
GSM475281 3.3773
GSM678422 0
The Expression of piRNA: piR-mmu-1145
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.