Loading...

Detail Information of piRNA: piR-mmu-11363

General Information
piRBase Id piR-mmu-11363 Accession N/A
Organism Mouse Number of methods 3
Sequence TGCTAGGAGCCGAGCCTCGGCAGAGA Number of papers 9
Length 26 Golden piRNA -
Aliases PIR190196;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
63 GSM319959 1 18922463 small RNA 2 dpp testis
121 GSM545783 4 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 1 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 10 20022248 Miwi IP adult testis
133 GSM475280 118 20022248 Mili IP adult testis
225 GSM1528807 244 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 337 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 255 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 475 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 17 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 33 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 49 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 7 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 10 20022248 Miwi-IP testis 
346 GSM475280 118 20022248 Mili-IP testis 
347 GSM475281 88 20022248 small RNA testis 
441 GSM1096582 45 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 451 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 491 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 161 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 510 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 28 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 92 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 169 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 403 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 165 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 189 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27320783-27320809:-
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0.683
GSM319960 0
GSM319961 0
GSM400967 1.5533
Sample CPM
GSM400968 0.7816
GSM400969 0
GSM433288 3.9812
GSM433289 7.2185
GSM433290 10.4063
GSM433291 2.4901
GSM433292 7.7801
GSM433293 11.0599
GSM433294 0
GSM433295 0
GSM475279 0.9605
GSM475280 10.7286
GSM475281 8.2555
GSM678422 0
The Expression of piRNA: piR-mmu-11363
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.