Loading...
| piRBase Id | piR-mmu-112427 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 3 |
| Sequence | TGAGATCCAACTGTAAGGCATTTTCTCAA | Number of papers | 11 |
| Length | 29 | Golden piRNA | - |
| Aliases | N/A | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 11 | GSM822760 | 15 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/+ |
| 12 | GSM822758 | 585 | 22121019 | Miwi IP | Testes, C57BL/6 P14 Miwi +/+ |
| 13 | GSM822759 | 39 | 22121019 | Miwi IP | Testes, C57BL/6 P20 Miwi +/+ |
| 14 | GSM822761 | 64 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 15 | GSM822762 | 9 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 16 | GSM822763 | 8 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 17 | GSM822764 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 50 | GSM610965 | 55 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
| 51 | GSM610966 | 209 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 167 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 61 | GSM319957 | 1 | 18922463 | Miwi2 IP | 16.5 dpc testis |
| 66 | GSM509275 | 57 | 20439430 | small RNA | MitoPLD+/+ E16.5 testis |
| 67 | GSM509276 | 2 | 20439430 | small RNA | MitoPLD-/- E16.5 testis |
| 68 | GSM509277 | 32 | 20439430 | small RNA | Mili-/- E16.5 testis |
| 69 | GSM509278 | 124 | 20439430 | small RNA | Miwi2-/- E16.5 testis |
| 74 | N/A | 1 | 22020280 | Mili IP | Mili_MiliDAH_2 E16.5 fetal testis |
| 76 | N/A | 1 | 22020280 | Mili IP | Miwi2DAH_2 E16.5 fetal testis |
| 81 | N/A | 1 | 22020280 | Mili IP | wild_type_1 E16.5 fetal testis |
| 86 | N/A | 2 | 22020280 | Miwi2 IP | Miwi2DAH_2 E16.5 fetal testis |
| 114 | GSM958035 | 13 | 22902560 | Mili IP | Fkbp6 +/-,P0,testis |
| 115 | GSM958036 | 7 | 22902560 | Mili IP | Fkbp6 -/-,P0,testis |
| 116 | GSM958037 | 1809 | 22902560 | Mili IP | Fkbp6 +/-,P10,testis |
| 117 | GSM958038 | 382 | 22902560 | Mili IP | Fkbp6 -/-,P10,testis |
| 118 | GSM958039 | 2 | 22902560 | Mili IP | Tdrd1 +/-,E18,testis |
| 119 | GSM958040 | 9 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
| 120 | GSM958041 | 477 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
| 132 | GSM475279 | 2 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 2 | 20022248 | Mili IP | adult testis |
| 224 | GSM1528806 | 164 | 26588211 | small RNA | 10dpp testes |
| 225 | GSM1528807 | 3 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 5 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 18 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 10 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 1 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 2 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 240 | GSM433294 | 1 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
| 345 | GSM475279 | 2 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 2 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 6 | 20022248 | small RNA | testis |
| 365 | GSM2500217 | N/A | 31358756 | samll RNA(CAS-seq) | oocyte(age: 8 to 10 weeks old, female mice; B6D2F1) |
| 441 | GSM1096582 | 11 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 53 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 8 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 322 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 44 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 3 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 5 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 2 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 1 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 3:140235369-140235398:+ | ||
| Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC | |||
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 2.4662 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0.5154 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 0 |
| Sample | CPM |
|---|---|
| GSM400968 | 0 |
| GSM400969 | 0 |
| GSM433288 | 0.2342 |
| GSM433289 | 0.4375 |
| GSM433290 | 0 |
| GSM433291 | 0 |
| GSM433292 | 0 |
| GSM433293 | 0 |
| GSM433294 | 0.2347 |
| GSM433295 | 0 |
| GSM475279 | 0.1921 |
| GSM475280 | 0.1818 |
| GSM475281 | 0.5629 |
| GSM678422 | 0 |
| Target gene | Target trans | Mechanism | Target site | Verified | PubMed |
|---|---|---|---|---|---|
| Hmmr | NM_013552 | cleavage | mm9 chr11:40515856-40515876:- | n | 25582079 |
| No record. |
| No record. |
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
|---|---|---|---|
| Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
| Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. | ||
| PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
|---|---|---|---|
| Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
| Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 31358756 | Journal | Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8. |
|---|---|---|---|
| Title | Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes. | ||
| Authors | Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L. | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||