Loading...

Detail Information of piRNA: piR-mmu-1117

General Information
piRBase Id piR-mmu-1117 Accession DQ549874
Organism Mouse Number of methods 3
Sequence TGCCAGAAGAGAAGAGACACACCCAC Number of papers 7
Length 26 Golden piRNA Y
Aliases piR-17986; PIR10985;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
52 GSM610967 7 21602304 small RNA Male germ cell, Round spermatids
115 GSM958036 1 22902560 Mili IP Fkbp6 -/-,P0,testis
132 GSM475279 9 20022248 Miwi IP adult testis
133 GSM475280 133 20022248 Mili IP adult testis
225 GSM1528807 22 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 15 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 23 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 18 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 17 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 14 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 18 26115953 small RNA 25dpp hetero tdrd6 KO testes
345 GSM475279 9 20022248 Miwi-IP testis 
346 GSM475280 133 20022248 Mili-IP testis 
347 GSM475281 34 20022248 small RNA testis 
445 GSM1096584 4 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 1 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 1 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 4 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 10 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 2 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:62226336-62226362:- Zfp37 ENSMUST00000212325;
Location 2 4:62233168-62233194:+
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 3.9812
GSM433289 3.0624
GSM433290 3.8227
GSM433291 0
GSM433292 1.945
GSM433293 2.1269
GSM433294 0
GSM433295 0
GSM475279 0.8645
GSM475280 12.0924
GSM475281 3.1896
GSM678422 0
The Expression of piRNA: piR-mmu-1117

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.