Loading...

Detail Information of piRNA: piR-mmu-11089

General Information
piRBase Id piR-mmu-11089 Accession DQ694038
Organism Mouse Number of methods 5
Sequence TATCAGTGTTGAGATGGGAAGTTTCC Number of papers 10
Length 26 Golden piRNA -
Aliases piR-109360; PIR189886; PIR202686;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
31 GSM684624 3 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 163 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 141 22842725 Mili CLIP C57BL/6 adult testis
37 GSM684622 59 22842725 Mili CLIP C57BL/6 adult testis
38 GSM684623 141 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 65 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 51 21602304 small RNA Male germ cell, Round spermatids
64 GSM319960 1 18922463 small RNA 10 dpp testis
65 GSM319961 1 18922463 small RNA 10 dpp MILI KO testis
132 GSM475279 4 20022248 Miwi IP adult testis
133 GSM475280 11 20022248 Mili IP adult testis
217 GSM1653802 108 25582079 MIWI CLIP round spermatids
225 GSM1528807 104 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 69 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 158 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 101 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 19 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 38 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 10 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 10 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 4 20022248 Miwi-IP testis 
346 GSM475280 11 20022248 Mili-IP testis 
347 GSM475281 23 20022248 small RNA testis 
443 GSM1096583 11 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 12 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 4 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 2 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 16 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 16 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 11 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 7 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:62221510-62221536:- Zfp37 ENSMUST00000212325;
Location 2 4:62237990-62238016:+
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0.4991
GSM319961 2.0518
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 4.4496
GSM433289 8.3122
GSM433290 2.1237
GSM433291 3.5573
GSM433292 3.1607
GSM433293 2.9777
GSM433294 0
GSM433295 0
GSM475279 0.3842
GSM475280 1.0001
GSM475281 2.1577
GSM678422 0
The Expression of piRNA: piR-mmu-11089
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.