Loading...

Detail Information of piRNA: piR-mmu-1104

General Information
piRBase Id piR-mmu-1104 Accession DQ549862
Organism Mouse Number of methods 4
Sequence TGCCACTGGAGTTACAGCTTTTCTTGGAC Number of papers 11
Length 29 Golden piRNA -
Aliases piR-17974; PIR10973;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
11 GSM822760 27 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 18 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 23 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 35 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
17 GSM822764 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
32 GSM684625 1 22842725 Miwi CLIP C57BL/6 adult testis
34 GSM684627 3 22842725 Miwi CLIP C57BL/6 adult testis
52 GSM610967 3 21602304 small RNA Male germ cell, Round spermatids
67 GSM509276 1 20439430 small RNA MitoPLD-/- E16.5 testis
71 GSM509280 1 20439430 small RNA MitoPLD-/- 10 dpp testis
129 GSM466729 3 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 11 20022248 Miwi IP adult testis
133 GSM475280 8 20022248 Mili IP adult testis
217 GSM1653802 18 25582079 MIWI CLIP round spermatids
225 GSM1528807 23 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 32 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 51 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 61 26588211 small RNA Adult testes Asb1 ao36(KO)
235 GSM433289 5 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 4 26115953 small RNA 25dpp hetero tdrd6 KO testes
345 GSM475279 11 20022248 Miwi-IP testis 
346 GSM475280 8 20022248 Mili-IP testis 
347 GSM475281 16 20022248 small RNA testis 
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 20 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 35 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 38 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 16 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 6 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 30 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 9 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 19 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 4 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 18:67062034-67062063:- LINE L1 Lx5;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 0
GSM433289 1.0937
GSM433290 0.8495
GSM433291 0
GSM433292 1.2156
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 1.0566
GSM475280 0.7274
GSM475281 1.501
GSM678422 0
The Expression of piRNA: piR-mmu-1104
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.