Loading...

Detail Information of piRNA: piR-mmu-11029

General Information
piRBase Id piR-mmu-11029 Accession AB251135
Organism Mouse Number of methods 4
Sequence TTGTAGACATGAGGATGGTTATGATC Number of papers 15
Length 26 Golden piRNA -
Aliases PIR189831; gsRNA165;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
10 N/A N/A 16766680 small RNA testis
11 GSM822760 3 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
13 GSM822759 3 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 17 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
35 GSM684620 1 22842725 Mili CLIP C57BL/6 adult testis
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 408 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 232 21602304 small RNA Male germ cell, Round spermatids
65 GSM319961 1 18922463 small RNA 10 dpp MILI KO testis
66 GSM509275 5 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 1 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 2 20439430 small RNA Mili-/- E16.5 testis
80 N/A 2 22020280 Mili IP Miwi2-/-_2 E16.5 fetal testis
118 GSM958039 1 22902560 Mili IP Tdrd1 +/-,E18,testis
121 GSM545783 128 20534472 Mov10L1 IP wild type adult testis
126 GSM466728 107 20059948 Mili IP Tdrd9+/- 14dpp testis
129 GSM466729 97 20059948 Mili IP Tdrd9+/- 14dpp testis
132 GSM475279 32 20022248 Miwi IP adult testis
133 GSM475280 225 20022248 Mili IP adult testis
225 GSM1528807 270 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 571 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 490 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 646 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 42 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 43 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 68 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 32 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 32 20022248 Miwi-IP testis 
346 GSM475280 225 20022248 Mili-IP testis 
347 GSM475281 132 20022248 small RNA testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 29 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 12 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 7 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 9 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 36 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 29 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 13 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 19 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 8:92190611-92190637:+ LINE L1 L1MCa;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 2.0518
GSM400967 91.9575
Sample CPM
GSM400968 236.8165
GSM400969 4.013
GSM433288 9.8359
GSM433289 9.4059
GSM433290 14.4414
GSM433291 11.3833
GSM433292 7.7801
GSM433293 11.0599
GSM433294 0
GSM433295 0
GSM475279 3.0737
GSM475280 20.457
GSM475281 12.3833
GSM678422 0
The Expression of piRNA: piR-mmu-11029
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 16766680 Journal Genes Dev. 2006 Jul 1;20(13):1709-14.
Title A novel class of small RNAs in mouse spermatogenic cells.
Authors Grivna ST, Beyret E, Wang Z, Lin H.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20534472 Journal Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6.
Title Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway.
Authors Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.