Loading...
| piRBase Id | piR-mmu-11021 | Accession | N/A |
|---|---|---|---|
| Organism | Mouse | Number of methods | 4 |
| Sequence | TCAGAGATCGATGCTGACTTCAGGA | Number of papers | 14 |
| Length | 25 | Golden piRNA | Y |
| Aliases | PIR189823; | ||
| Dataset | Accession | Reads | PubMed | Method | Tissue |
|---|---|---|---|---|---|
| 5 | N/A | N/A | 16751777 | MILI IP | testis |
| 14 | GSM822761 | 2 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi +/ADH |
| 15 | GSM822762 | 1 | 22121019 | Miwi IP | Testes, C57BL/6 Adult Miwi -/ADH |
| 35 | GSM684620 | 1 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 36 | GSM684621 | 1 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 37 | GSM684622 | 1 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 38 | GSM684623 | 1 | 22842725 | Mili CLIP | C57BL/6 adult testis |
| 51 | GSM610966 | 4 | 21602304 | small RNA | Male germ cell, Pachytene spermatocytes |
| 52 | GSM610967 | 1 | 21602304 | small RNA | Male germ cell, Round spermatids |
| 66 | GSM509275 | 1 | 20439430 | small RNA | MitoPLD+/+ E16.5 testis |
| 67 | GSM509276 | 1 | 20439430 | small RNA | MitoPLD-/- E16.5 testis |
| 73 | N/A | 5 | 22020280 | Mili IP | Mili_MiliDAH_1 E16.5 fetal testis |
| 74 | N/A | 2 | 22020280 | Mili IP | Mili_MiliDAH_2 E16.5 fetal testis |
| 75 | N/A | 2 | 22020280 | Mili IP | Miwi2DAH_1 E16.5 fetal testis |
| 76 | N/A | 6 | 22020280 | Mili IP | Miwi2DAH_2 E16.5 fetal testis |
| 77 | N/A | 3 | 22020280 | Mili IP | Miwi2+/-_1 E16.5 fetal testis |
| 78 | N/A | 2 | 22020280 | Mili IP | Miwi2+/-_2 E16.5 fetal testis |
| 79 | N/A | 4 | 22020280 | Mili IP | Miwi2-/-_1 E16.5 fetal testis |
| 80 | N/A | 1 | 22020280 | Mili IP | Miwi2-/-_2 E16.5 fetal testis |
| 81 | N/A | 4 | 22020280 | Mili IP | wild_type_1 E16.5 fetal testis |
| 82 | N/A | 4 | 22020280 | Mili IP | wild_type_2 E16.5 fetal testis |
| 119 | GSM958040 | 5 | 22902560 | Mili IP | Tdrd1 -/-,E18,testis |
| 121 | GSM545783 | 37 | 20534472 | Mov10L1 IP | wild type adult testis |
| 126 | GSM466728 | 2 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 129 | GSM466729 | 4 | 20059948 | Mili IP | Tdrd9+/- 14dpp testis |
| 132 | GSM475279 | 28 | 20022248 | Miwi IP | adult testis |
| 133 | GSM475280 | 109 | 20022248 | Mili IP | adult testis |
| 217 | GSM1653802 | 1 | 25582079 | MIWI CLIP | round spermatids |
| 224 | GSM1528806 | 8 | 26588211 | small RNA | 10dpp testes |
| 225 | GSM1528807 | 930 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
| 226 | GSM1528808 | 1657 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
| 227 | GSM1528809 | 1051 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
| 228 | GSM1528810 | 1329 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
| 234 | GSM433288 | 5 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
| 235 | GSM433289 | 14 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
| 236 | GSM433290 | 12 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
| 237 | GSM433291 | 1 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
| 345 | GSM475279 | 28 | 20022248 | Miwi-IP | testis |
| 346 | GSM475280 | 109 | 20022248 | Mili-IP | testis |
| 347 | GSM475281 | 26 | 20022248 | small RNA | testis |
| 441 | GSM1096582 | 41 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
| 442 | GSM1096599 | 68 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
| 443 | GSM1096583 | 1802 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
| 444 | GSM1096600 | 1429 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
| 445 | GSM1096584 | 450 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
| 446 | GSM1096601 | 1228 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
| 447 | GSM1096585 | 75 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
| 448 | GSM1096602 | 216 | 23523368 | oxidized small RNA | Wild Type 17.5 dpp testes |
| 449 | GSM1096586 | 172 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
| 450 | GSM1096603 | 510 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
| 451 | GSM1096587 | 166 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
| 452 | GSM1096604 | 263 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
| No. | Location | Gene | RepeatMaker |
|---|---|---|---|
| Location 1 | 8:92189756-92189781:+ | LINE L1 L1MCa; |
| Sample | CPM |
|---|---|
| GSM179088 | 0 |
| GSM261957 | 0 |
| GSM261958 | 0 |
| GSM261959 | 0 |
| GSM319953 | 0 |
| GSM319954 | 0 |
| GSM319955 | 0 |
| GSM319956 | 0 |
| GSM319957 | 0 |
| GSM319958 | 0 |
| GSM319959 | 0 |
| GSM319960 | 0 |
| GSM319961 | 0 |
| GSM400967 | 22.0574 |
| Sample | CPM |
|---|---|
| GSM400968 | 22.6656 |
| GSM400969 | 1.0032 |
| GSM433288 | 1.1709 |
| GSM433289 | 3.0624 |
| GSM433290 | 2.5485 |
| GSM433291 | 0.3557 |
| GSM433292 | 2.6744 |
| GSM433293 | 1.7015 |
| GSM433294 | 0 |
| GSM433295 | 0 |
| GSM475279 | 2.6895 |
| GSM475280 | 9.9103 |
| GSM475281 | 2.4391 |
| GSM678422 | 0.0531 |
| No record. |
| No record. |
| No record. |
| No record. |
| PubMed | 16751777 | Journal | Nature. 2006 Jul 13;442(7099):203-7. |
|---|---|---|---|
| Title | A novel class of small RNAs bind to MILI protein in mouse testes | ||
| Authors | Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T. | ||
| PubMed | 22121019 | Journal | Nature. 2011 Nov 27;480(7376):264-7. |
|---|---|---|---|
| Title | Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. | ||
| Authors | Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. | ||
| PubMed | 22842725 | Journal | Nat Struct Mol Biol. 2012 Aug;19(8):773-81. |
|---|---|---|---|
| Title | Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. | ||
| Authors | Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. | ||
| PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
|---|---|---|---|
| Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
| Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. | ||
| PubMed | 20439430 | Journal | Genes Dev. 2010 May;24(9):887-92. |
|---|---|---|---|
| Title | MVH in piRNA processing and gene silencing of retrotransposons. | ||
| Authors | Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T. | ||
| PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
|---|---|---|---|
| Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
| Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. | ||
| PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
|---|---|---|---|
| Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
| Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. | ||
| PubMed | 20534472 | Journal | Proc Natl Acad Sci U S A. 2010 Jun 29;107(26):11841-6. |
|---|---|---|---|
| Title | Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. | ||
| Authors | Zheng K, Xiol J, Reuter M, Eckardt S, Leu NA, McLaughlin KJ, Stark A, Sachidanandam R, Pillai RS, Wang PJ. | ||
| PubMed | 20059948 | Journal | Dev Cell. 2009 Dec;17(6):775-87. |
|---|---|---|---|
| Title | The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline. | ||
| Authors | Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S. | ||
| PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
|---|---|---|---|
| Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
| Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. | ||
| PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
|---|---|---|---|
| Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
| Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. | ||
| PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
|---|---|---|---|
| Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
| Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. | ||
| PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
|---|---|---|---|
| Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
| Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ | ||
| PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
|---|---|---|---|
| Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
| Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. | ||