Loading...

Detail Information of piRNA: piR-mmu-1090

General Information
piRBase Id piR-mmu-1090 Accession DQ549849
Organism Mouse Number of methods 2
Sequence TGCCACTCAGGAATTTAGCATGGGACTTCT Number of papers 4
Length 30 Golden piRNA -
Aliases piR-17961; PIR10960;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
131 GSM466731 1 20059948 Mili IP Tdrd9-/- 14dpp testis
228 GSM1528810 1 26588211 small RNA Adult testes Asb1 ao36(KO)
Location in GRCm38
2 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 6:72349575-72349605:+ 0610030E20Rik ENSMUST00000077783; 0610030E20Rik ENSMUST00000205578; 0610030E20Rik ENSMUST00000204152; SINE B4 B4A;
Location 2 CHR_MG184_PATCH:72349574-72349604:+
piRNA Expression
No record.
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 20059948 Journal Dev Cell. 2009 Dec;17(6):775-87.
Title The TDRD9-MIWI2 complex is essential for piRNA-mediated retrotransposon silencing in the mouse male germline.
Authors Shoji M, Tanaka T, Hosokawa M, Reuter M, Stark A, Kato Y, Kondoh G, Okawa K, Chujo T, Suzuki T, Hata K, Martin SL, Noce T, Kuramochi-Miyagawa S, Nakano T, Sasaki H, Pillai RS, Nakatsuji N, Chuma S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.