Loading...

Detail Information of piRNA: piR-mmu-1089

General Information
piRBase Id piR-mmu-1089 Accession DQ539985
Organism Mouse Number of methods 4
Sequence ACACCTTTCATCTTGAGGATGCCTGTCCA Number of papers 7
Length 29 Golden piRNA -
Aliases piR-97; PIR1096;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
12 GSM822758 3 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
16 GSM822763 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 1 21602304 small RNA Male germ cell, Type A spermatogonia
51 GSM610966 7 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 5 21602304 small RNA Male germ cell, Round spermatids
217 GSM1653802 15 25582079 MIWI CLIP round spermatids
225 GSM1528807 11 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 20 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 28 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 30 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 55 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 22 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 18 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 19 26115953 small RNA 25dpp homo tdrd6 KO testes
238 GSM433292 14 26115953 small RNA 6 weeks hetero tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
441 GSM1096582 2 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 18 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 1 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 146 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 36 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 11 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 23 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 4 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
38 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 4:41895198-41895227:+ Gm13307 ENSMUST00000141375; Gm13302 ENSMUST00000119405;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 12.8804
GSM433289 4.8123
GSM433290 3.8227
GSM433291 6.7588
GSM433292 3.4038
GSM433293 8.5076
GSM433294 0.2347
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-1089
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.