Loading...

Detail Information of piRNA: piR-mmu-10541

General Information
piRBase Id piR-mmu-10541 Accession AB251171
Organism Mouse Number of methods 5
Sequence TAGCAGGATGTTTTTGGATTCAGGT Number of papers 13
Length 25 Golden piRNA Y
Aliases piR-108386; PIR189357; PIR189373; PIR189421; PIR192047; PIR192191; PIR201712; gsRNA201;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
10 N/A N/A 16766680 small RNA testis
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 2 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
13 GSM822759 1 22121019 Miwi IP Testes, C57BL/6 P20 Miwi +/+
14 GSM822761 31 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/ADH
15 GSM822762 4 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
16 GSM822763 2 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
31 GSM684624 19 22842725 Miwi CLIP C57BL/6 adult testis
32 GSM684625 10 22842725 Miwi CLIP C57BL/6 adult testis
33 GSM684626 5 22842725 Miwi CLIP C57BL/6 adult testis
35 GSM684620 54 22842725 Mili CLIP C57BL/6 adult testis
36 GSM684621 45 22842725 Mili CLIP C57BL/6 adult testis
51 GSM610966 29 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 13 21602304 small RNA Male germ cell, Round spermatids
66 GSM509275 6 20439430 small RNA MitoPLD+/+ E16.5 testis
67 GSM509276 4 20439430 small RNA MitoPLD-/- E16.5 testis
68 GSM509277 9 20439430 small RNA Mili-/- E16.5 testis
69 GSM509278 1 20439430 small RNA Miwi2-/- E16.5 testis
71 GSM509280 1 20439430 small RNA MitoPLD-/- 10 dpp testis
114 GSM958035 1 22902560 Mili IP Fkbp6 +/-,P0,testis
132 GSM475279 673 20022248 Miwi IP adult testis
133 GSM475280 3382 20022248 Mili IP adult testis
217 GSM1653802 1 25582079 MIWI CLIP round spermatids
225 GSM1528807 937 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 1315 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 1149 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 1287 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 96 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 107 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 83 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 67 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 673 20022248 Miwi-IP testis 
346 GSM475280 3382 20022248 Mili-IP testis 
347 GSM475281 233 20022248 small RNA testis 
441 GSM1096582 162 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 146 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 282 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 761 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 1196 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 122 23523368 small RNA Wild Type 17.5 dpp testes
448 GSM1096602 296 23523368 oxidized small RNA Wild Type 17.5 dpp testes
449 GSM1096586 433 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 624 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 294 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 451 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
5 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 1:34602441-34602466:+
Location 2 10:85750626-85750651:+ SINE B4 B4;
Location 3 10:86589424-86589449:- LINE L1 Lx3_Mus;
Location 4 17:66153314-66153339:-
Location 5 17:66208863-66208888:+ SINE B4 RSINE1;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0
GSM319954 0
GSM319955 0
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 22.4822
GSM433289 23.4053
GSM433290 17.627
GSM433291 23.8337
GSM433292 13.8583
GSM433293 19.5675
GSM433294 0
GSM433295 0
GSM475279 64.6433
GSM475280 307.4922
GSM475281 21.8584
GSM678422 0
The Expression of piRNA: piR-mmu-10541
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 16766680 Journal Genes Dev. 2006 Jul 1;20(13):1709-14.
Title A novel class of small RNAs in mouse spermatogenic cells.
Authors Grivna ST, Beyret E, Wang Z, Lin H.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 22842725 Journal Nat Struct Mol Biol. 2012 Aug;19(8):773-81.
Title Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis.
Authors Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.