Loading...

Detail Information of piRNA: piR-mmu-104

General Information
piRBase Id piR-mmu-104 Accession DQ719869
Organism Mouse Number of methods 3
Sequence TGCAATGAGACTAGCCTCGTGGGGTGCAA Number of papers 11
Length 29 Golden piRNA -
Aliases piR-17094; piR-135191; PIR10093; PIR228517;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
6 GSM113695 1 16778019 Chromatography testes tissue from Swiss Webster male mice, 8-10 weeks old
11 GSM822760 1 22121019 Miwi IP Testes, C57BL/6 Adult Miwi +/+
12 GSM822758 3 22121019 Miwi IP Testes, C57BL/6 P14 Miwi +/+
51 GSM610966 1 21602304 small RNA Male germ cell, Pachytene spermatocytes
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
61 GSM319957 1 18922463 Miwi2 IP 16.5 dpc testis
71 GSM509280 1 20439430 small RNA MitoPLD-/- 10 dpp testis
83 N/A 1 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 3 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
225 GSM1528807 17 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 14 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 34 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 7 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 9 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 9 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 4 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 3 26115953 small RNA 25dpp homo tdrd6 KO testes
443 GSM1096583 10 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 9 23523368 small RNA Wild Type 14.5 dpp testes
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 6 23523368 small RNA Wild Type 20.5 dpp testes
451 GSM1096587 3 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
631 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 9:77333688-77333717:- Mlip ENSMUST00000034910; Mlip ENSMUST00000185144; Mlip ENSMUST00000184415; Mlip ENSMUST00000184848; Mlip ENSMUST00000185039; Mlip ENSMUST00000184006; Mlip ENSMUST00000184138; Mlip ENSMUST00000184106;
Hits not all shown! To search for more loci, you can Run Bowtie here or Blat in UCSC
piRNA Expression
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 2.1077
GSM433289 1.9687
GSM433290 0.8495
GSM433291 1.0672
GSM433292 0.4863
GSM433293 0.8508
GSM433294 0
GSM433295 0
GSM475279 0
GSM475280 0
GSM475281 0
GSM678422 0
The Expression of piRNA: piR-mmu-104
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 16778019 Journal Science. 2006 Jul 21;313(5785):363-7.
Title Characterization of the piRNA complex from rat testes.
Authors Lau NC, Seto AG, Kim J, Kuramochi-Miyagawa S, Nakano T, Bartel DP, Kingston RE.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20439430 Journal Genes Dev. 2010 May;24(9):887-92.
Title MVH in piRNA processing and gene silencing of retrotransposons.
Authors Kuramochi-Miyagawa S, Watanabe T, Gotoh K, Takamatsu K, Chuma S, Kojima-Kita K, Shiromoto Y, Asada N, Toyoda A, Fujiyama A, Totoki Y, Shibata T, Kimura T, Nakatsuji N, Noce T, Sasaki H, Nakano T.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.