Loading...

Detail Information of piRNA: piR-mmu-10255

General Information
piRBase Id piR-mmu-10255 Accession DQ540780
Organism Mouse Number of methods 2
Sequence CCATGGTGACCACGGGTGACGGGGAA Number of papers 11
Length 26 Golden piRNA -
Aliases piR-892; PIR1891;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
16 GSM822763 11 22121019 Miwi IP Testes, C57BL/6 Adult Miwi -/ADH
50 GSM610965 5 21602304 small RNA Male germ cell, Type A spermatogonia
52 GSM610967 1 21602304 small RNA Male germ cell, Round spermatids
57 GSM319953 1 18922463 Mili IP 10 dpp Dnmt3L heterozygotes testis
59 GSM319955 1 18922463 small RNA 16.5 dpc testis
62 GSM319958 2 18922463 small RNA 4-6 week ovary
63 GSM319959 16 18922463 small RNA 2 dpp testis
64 GSM319960 30 18922463 small RNA 10 dpp testis
65 GSM319961 43 18922463 small RNA 10 dpp MILI KO testis
86 N/A 1 22020280 Miwi2 IP Miwi2DAH_2 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
114 GSM958035 2 22902560 Mili IP Fkbp6 +/-,P0,testis
116 GSM958037 23 22902560 Mili IP Fkbp6 +/-,P10,testis
117 GSM958038 1 22902560 Mili IP Fkbp6 -/-,P10,testis
120 GSM958041 1 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 4 20022248 Miwi IP adult testis
133 GSM475280 2 20022248 Mili IP adult testis
224 GSM1528806 1 26588211 small RNA 10dpp testes
225 GSM1528807 6 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 5 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 5 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 12 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 5 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 10 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 3 26115953 small RNA 25dpp hetero tdrd6 KO testes
238 GSM433292 1 26115953 small RNA 6 weeks hetero tdrd6 KO testes
240 GSM433294 1 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
247 GSM1318060 1 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 4 20022248 Miwi-IP testis 
346 GSM475280 2 20022248 Mili-IP testis 
347 GSM475281 1 20022248 small RNA testis 
443 GSM1096583 14 23523368 small RNA Wild Type 12.5 dpp testes
445 GSM1096584 1 23523368 small RNA Wild Type 14.5 dpp testes
451 GSM1096587 1 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:39846748-39846774:+ CT010467.1 ENSMUST00000198477;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0
GSM261958 0
GSM261959 0
GSM319953 0.7538
GSM319954 0
GSM319955 0.6068
GSM319956 0
GSM319957 0
GSM319958 3.2227
GSM319959 10.9281
GSM319960 14.9723
GSM319961 88.2272
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 1.1709
GSM433289 2.1874
GSM433290 0.6371
GSM433291 0
GSM433292 0.2431
GSM433293 1.2761
GSM433294 0.2347
GSM433295 0.4757
GSM475279 0.3842
GSM475280 0.1818
GSM475281 0.0938
GSM678422 0
The Expression of piRNA: piR-mmu-10255
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 22121019 Journal Nature. 2011 Nov 27;480(7376):264-7.
Title Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing.
Authors Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.