Loading...

Detail Information of piRNA: piR-mmu-10092

General Information
piRBase Id piR-mmu-10092 Accession N/A
Organism Mouse Number of methods 4
Sequence TAGAAACATGATTCAGGGTTTATGAA Number of papers 8
Length 26 Golden piRNA Y
Aliases PIR188951;
Datasets
Dataset Accession Reads PubMed Method Tissue
5 N/A N/A 16751777 MILI IP testis
52 GSM610967 2 21602304 small RNA Male germ cell, Round spermatids
64 GSM319960 1 18922463 small RNA 10 dpp testis
132 GSM475279 1 20022248 Miwi IP adult testis
133 GSM475280 58 20022248 Mili IP adult testis
217 GSM1653802 4 25582079 MIWI CLIP round spermatids
225 GSM1528807 19 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 20 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 19 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 19 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 2 26115953 small RNA 18dpp hetero tdrd6 KO testes
236 GSM433290 7 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 4 26115953 small RNA 25dpp homo tdrd6 KO testes
345 GSM475279 1 20022248 Miwi-IP testis 
346 GSM475280 58 20022248 Mili-IP testis 
347 GSM475281 10 20022248 small RNA testis 
441 GSM1096582 1 23523368 small RNA Wild Type 10.5 dpp testes
443 GSM1096583 6 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 12 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 12 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 47 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 2 23523368 small RNA Wild Type 17.5 dpp testes
450 GSM1096603 8 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 4 23523368 small RNA Wild Type 6 weeks dpp testes
452 GSM1096604 1 23523368 oxidized small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 17:27309738-27309764:- Gm49793 ENSMUST00000232564; SINE B4 B4A; LTR ERVK RLTR51A_Mm;
piRNA Expression
Sample CPM
GSM400968 0.3908
GSM400969 0
GSM433288 0.4684
GSM433289 0
GSM433290 1.4866
GSM433291 1.4229
GSM433292 0.2431
GSM433293 0.4254
GSM433294 0
GSM433295 0
GSM475279 0.0961
GSM475280 5.2734
GSM475281 0.9381
GSM678422 0
The Expression of piRNA: piR-mmu-10092
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751777 Journal Nature. 2006 Jul 13;442(7099):203-7.
Title A novel class of small RNAs bind to MILI protein in mouse testes
Authors Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 25582079 Journal Cell Res. 2015 Feb;25(2):193-207.
Title MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes.
Authors Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.