Loading...
piRBase Id | piR-mmu-10092 | Accession | N/A |
---|---|---|---|
Organism | Mouse | Number of methods | 4 |
Sequence | TAGAAACATGATTCAGGGTTTATGAA | Number of papers | 8 |
Length | 26 | Golden piRNA | Y |
Aliases | PIR188951; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
5 | N/A | N/A | 16751777 | MILI IP | testis |
52 | GSM610967 | 2 | 21602304 | small RNA | Male germ cell, Round spermatids |
64 | GSM319960 | 1 | 18922463 | small RNA | 10 dpp testis |
132 | GSM475279 | 1 | 20022248 | Miwi IP | adult testis |
133 | GSM475280 | 58 | 20022248 | Mili IP | adult testis |
217 | GSM1653802 | 4 | 25582079 | MIWI CLIP | round spermatids |
225 | GSM1528807 | 19 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 20 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 19 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 19 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
234 | GSM433288 | 2 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
236 | GSM433290 | 7 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
237 | GSM433291 | 4 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
345 | GSM475279 | 1 | 20022248 | Miwi-IP | testis |
346 | GSM475280 | 58 | 20022248 | Mili-IP | testis |
347 | GSM475281 | 10 | 20022248 | small RNA | testis |
441 | GSM1096582 | 1 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 6 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 12 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 12 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 47 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
447 | GSM1096585 | 2 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
450 | GSM1096603 | 8 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 4 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
452 | GSM1096604 | 1 | 23523368 | oxidized small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 17:27309738-27309764:- | Gm49793 ENSMUST00000232564; | SINE B4 B4A; LTR ERVK RLTR51A_Mm; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0 |
GSM261958 | 0 |
GSM261959 | 0 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 0 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0.4991 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0.3908 |
GSM400969 | 0 |
GSM433288 | 0.4684 |
GSM433289 | 0 |
GSM433290 | 1.4866 |
GSM433291 | 1.4229 |
GSM433292 | 0.2431 |
GSM433293 | 0.4254 |
GSM433294 | 0 |
GSM433295 | 0 |
GSM475279 | 0.0961 |
GSM475280 | 5.2734 |
GSM475281 | 0.9381 |
GSM678422 | 0 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751777 | Journal | Nature. 2006 Jul 13;442(7099):203-7. |
---|---|---|---|
Title | A novel class of small RNAs bind to MILI protein in mouse testes | ||
Authors | Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T, Chien M, Russo JJ, Ju J, Sheridan R, Sander C, Zavolan M, Tuschl T. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 25582079 | Journal | Cell Res. 2015 Feb;25(2):193-207. |
---|---|---|---|
Title | MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. | ||
Authors | Zhang P, Kang JY, Gou LT, Wang J, Xue Y, Skogerboe G, Dai P, Huang DW, Chen R, Fu XD, Liu MF, He S. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |