Loading...
piRBase Id | piR-mmu-1008 | Accession | DQ549760 |
---|---|---|---|
Organism | Mouse | Number of methods | 3 |
Sequence | TGCCAATGATGACACCACACTAACTGAGC | Number of papers | 11 |
Length | 29 | Golden piRNA | - |
Aliases | piR-17872; PIR10871; |
Dataset | Accession | Reads | PubMed | Method | Tissue |
---|---|---|---|---|---|
4 | N/A | N/A | 16751776 | small RNA | testis |
50 | GSM610965 | 5 | 21602304 | small RNA | Male germ cell, Type A spermatogonia |
59 | GSM319955 | 6 | 18922463 | small RNA | 16.5 dpc testis |
83 | N/A | 1 | 22020280 | Miwi2 IP | MiliDAH_1 E16.5 fetal testis |
84 | N/A | 3 | 22020280 | Miwi2 IP | MiliDAH_2 E16.5 fetal testis |
88 | N/A | 1 | 22020280 | Miwi2 IP | wild_type_2 E16.5 fetal testis |
120 | GSM958041 | 1 | 22902560 | Miwi2 IP | Tdrd1 +/-,E18,testis |
132 | GSM475279 | 8 | 20022248 | Miwi IP | adult testis |
133 | GSM475280 | 7 | 20022248 | Mili IP | adult testis |
225 | GSM1528807 | 21 | 26588211 | small RNA | Adult testes Asb1 ao31(Het) |
226 | GSM1528808 | 17 | 26588211 | small RNA | Adult testes Asb1 ao32(KO) |
227 | GSM1528809 | 54 | 26588211 | small RNA | Adult testes Asb1 ao34(Het) |
228 | GSM1528810 | 33 | 26588211 | small RNA | Adult testes Asb1 ao36(KO) |
234 | GSM433288 | 35 | 26115953 | small RNA | 18dpp hetero tdrd6 KO testes |
235 | GSM433289 | 25 | 26115953 | small RNA | 18dpp homo tdrd6 KO testes |
236 | GSM433290 | 18 | 26115953 | small RNA | 25dpp hetero tdrd6 KO testes |
237 | GSM433291 | 7 | 26115953 | small RNA | 25dpp homo tdrd6 KO testes |
240 | GSM433294 | 34 | 26115953 | small RNA | 18.5dpc hetero tdrd1 KO testes |
246 | GSM1318059 | 21 | 25262350 | small RNA | E16.5 whole testes |
247 | GSM1318060 | 15 | 25262350 | small RNA | E16.5 whole testes Hsp90-alpha KO |
345 | GSM475279 | 8 | 20022248 | Miwi-IP | testis |
346 | GSM475280 | 7 | 20022248 | Mili-IP | testis |
347 | GSM475281 | 19 | 20022248 | small RNA | testis |
348 | GSM3772906 | 380 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
349 | GSM3772907 | 700 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
350 | GSM3772908 | 1523 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control) |
351 | GSM3772909 | 943 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
352 | GSM3772910 | 784 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
353 | GSM3772911 | 541 | 32674113 | small RNA | E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-) |
441 | GSM1096582 | 17 | 23523368 | small RNA | Wild Type 10.5 dpp testes |
442 | GSM1096599 | 17 | 23523368 | oxidized small RNA | Wild Type 10.5 dpp testes |
443 | GSM1096583 | 322 | 23523368 | small RNA | Wild Type 12.5 dpp testes |
444 | GSM1096600 | 15 | 23523368 | oxidized small RNA | Wild Type 12.5 dpp testes |
445 | GSM1096584 | 824 | 23523368 | small RNA | Wild Type 14.5 dpp testes |
446 | GSM1096601 | 141 | 23523368 | oxidized small RNA | Wild Type 14.5 dpp testes |
447 | GSM1096585 | 14 | 23523368 | small RNA | Wild Type 17.5 dpp testes |
449 | GSM1096586 | 18 | 23523368 | small RNA | Wild Type 20.5 dpp testes |
450 | GSM1096603 | 1 | 23523368 | oxidized small RNA | Wild Type 20.5 dpp testes |
451 | GSM1096587 | 11 | 23523368 | small RNA | Wild Type 6 weeks dpp testes |
No. | Location | Gene | RepeatMaker |
---|---|---|---|
Location 1 | 5:107904553-107904582:+ | Rpl5 ENSMUST00000082223; Rpl5 ENSMUST00000153590; Rpl5 ENSMUST00000140659; Snord21 ENSMUST00000082519; |
Sample | CPM |
---|---|
GSM179088 | 0 |
GSM261957 | 0.6375 |
GSM261958 | 20.5517 |
GSM261959 | 1.2516 |
GSM319953 | 0 |
GSM319954 | 0 |
GSM319955 | 3.6409 |
GSM319956 | 0 |
GSM319957 | 0 |
GSM319958 | 0 |
GSM319959 | 0 |
GSM319960 | 0 |
GSM319961 | 0 |
GSM400967 | 0 |
Sample | CPM |
---|---|
GSM400968 | 0 |
GSM400969 | 0 |
GSM433288 | 8.1966 |
GSM433289 | 5.4685 |
GSM433290 | 3.8227 |
GSM433291 | 2.4901 |
GSM433292 | 1.945 |
GSM433293 | 2.1269 |
GSM433294 | 7.9781 |
GSM433295 | 17.3621 |
GSM475279 | 0.7684 |
GSM475280 | 0.6364 |
GSM475281 | 1.7824 |
GSM678422 | 0.3714 |
No record. |
No record. |
No record. |
No record. |
PubMed | 16751776 | Journal | Nature. 2006 Jul 13;442(7099):199-202. |
---|---|---|---|
Title | A germline-specific class of small RNAs binds mammalian Piwi proteins | ||
Authors | Girard A, Sachidanandam R, Hannon GJ, Carmell MA. |
PubMed | 21602304 | Journal | RNA. 2011 Jul;17(7):1191-203. |
---|---|---|---|
Title | piRNA profiling during specific stages of mouse spermatogenesis. | ||
Authors | Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C. |
PubMed | 18922463 | Journal | Mol Cell. 2008 Sep 26;31(6):785-99. |
---|---|---|---|
Title | A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice. | ||
Authors | Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. |
PubMed | 22020280 | Journal | Nature. 2011 Oct 23;480(7376):259-63. |
---|---|---|---|
Title | The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. | ||
Authors | De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. |
PubMed | 22902560 | Journal | Mol Cell. 2012 Sep 28;47(6):970-9. |
---|---|---|---|
Title | A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing. | ||
Authors | Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS. |
PubMed | 20022248 | Journal | Curr Biol. 2009 Dec 29;19(24):2066-76. |
---|---|---|---|
Title | A broadly conserved pathway generates 3'UTR-directed primary piRNAs. | ||
Authors | Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC. |
PubMed | 26588211 | Journal | PLoS Genet. 2015 Nov 20;11(11):e1005652 |
---|---|---|---|
Title | Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals | ||
Authors | Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC. |
PubMed | 26115953 | Journal | Genes Dev. 2015 Jul 1; 29(13): 1403?415 |
---|---|---|---|
Title | RNF17 blocks promiscuous activity of PIWI proteins in mouse testes | ||
Authors | Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ |
PubMed | 25262350 | Journal | Nucleic Acids Res. 2014 Oct 29;42(19):11903-11 |
---|---|---|---|
Title | HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse. | ||
Authors | Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H. |
PubMed | 32674113 | Journal | Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5. |
---|---|---|---|
Title | SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation. | ||
Authors | Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D. |
PubMed | 23523368 | Journal | Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016. |
---|---|---|---|
Title | An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes | ||
Authors | Li XZ, Roy CK, Dong X, Bolcun-Filas E et al. |