Loading...

Detail Information of piRNA: piR-mmu-1008

General Information
piRBase Id piR-mmu-1008 Accession DQ549760
Organism Mouse Number of methods 3
Sequence TGCCAATGATGACACCACACTAACTGAGC Number of papers 11
Length 29 Golden piRNA -
Aliases piR-17872; PIR10871;
Datasets
Dataset Accession Reads PubMed Method Tissue
4 N/A N/A 16751776 small RNA testis
50 GSM610965 5 21602304 small RNA Male germ cell, Type A spermatogonia
59 GSM319955 6 18922463 small RNA 16.5 dpc testis
83 N/A 1 22020280 Miwi2 IP MiliDAH_1 E16.5 fetal testis
84 N/A 3 22020280 Miwi2 IP MiliDAH_2 E16.5 fetal testis
88 N/A 1 22020280 Miwi2 IP wild_type_2 E16.5 fetal testis
120 GSM958041 1 22902560 Miwi2 IP Tdrd1 +/-,E18,testis
132 GSM475279 8 20022248 Miwi IP adult testis
133 GSM475280 7 20022248 Mili IP adult testis
225 GSM1528807 21 26588211 small RNA Adult testes Asb1 ao31(Het)
226 GSM1528808 17 26588211 small RNA Adult testes Asb1 ao32(KO)
227 GSM1528809 54 26588211 small RNA Adult testes Asb1 ao34(Het)
228 GSM1528810 33 26588211 small RNA Adult testes Asb1 ao36(KO)
234 GSM433288 35 26115953 small RNA 18dpp hetero tdrd6 KO testes
235 GSM433289 25 26115953 small RNA 18dpp homo tdrd6 KO testes
236 GSM433290 18 26115953 small RNA 25dpp hetero tdrd6 KO testes
237 GSM433291 7 26115953 small RNA 25dpp homo tdrd6 KO testes
240 GSM433294 34 26115953 small RNA 18.5dpc hetero tdrd1 KO testes
246 GSM1318059 21 25262350 small RNA E16.5 whole testes
247 GSM1318060 15 25262350 small RNA E16.5 whole testes Hsp90-alpha KO
345 GSM475279 8 20022248 Miwi-IP testis 
346 GSM475280 7 20022248 Mili-IP testis 
347 GSM475281 19 20022248 small RNA testis 
348 GSM3772906 380 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
349 GSM3772907 700 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
350 GSM3772908 1523 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; control)
351 GSM3772909 943 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
352 GSM3772910 784 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
353 GSM3772911 541 32674113 small RNA E16.5 testes(mixed B6CBAF1/Crl and C57BL/6N; Spocd1-/-)
441 GSM1096582 17 23523368 small RNA Wild Type 10.5 dpp testes
442 GSM1096599 17 23523368 oxidized small RNA Wild Type 10.5 dpp testes
443 GSM1096583 322 23523368 small RNA Wild Type 12.5 dpp testes
444 GSM1096600 15 23523368 oxidized small RNA Wild Type 12.5 dpp testes
445 GSM1096584 824 23523368 small RNA Wild Type 14.5 dpp testes
446 GSM1096601 141 23523368 oxidized small RNA Wild Type 14.5 dpp testes
447 GSM1096585 14 23523368 small RNA Wild Type 17.5 dpp testes
449 GSM1096586 18 23523368 small RNA Wild Type 20.5 dpp testes
450 GSM1096603 1 23523368 oxidized small RNA Wild Type 20.5 dpp testes
451 GSM1096587 11 23523368 small RNA Wild Type 6 weeks dpp testes
Location in GRCm38
1 best hit(s) with 0 mismatch(es) in GRCm38
No. Location Gene RepeatMaker
Location 1 5:107904553-107904582:+ Rpl5 ENSMUST00000082223; Rpl5 ENSMUST00000153590; Rpl5 ENSMUST00000140659; Snord21 ENSMUST00000082519;
piRNA Expression
Sample CPM
GSM179088 0
GSM261957 0.6375
GSM261958 20.5517
GSM261959 1.2516
GSM319953 0
GSM319954 0
GSM319955 3.6409
GSM319956 0
GSM319957 0
GSM319958 0
GSM319959 0
GSM319960 0
GSM319961 0
GSM400967 0
Sample CPM
GSM400968 0
GSM400969 0
GSM433288 8.1966
GSM433289 5.4685
GSM433290 3.8227
GSM433291 2.4901
GSM433292 1.945
GSM433293 2.1269
GSM433294 7.9781
GSM433295 17.3621
GSM475279 0.7684
GSM475280 0.6364
GSM475281 1.7824
GSM678422 0.3714
The Expression of piRNA: piR-mmu-1008
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 21602304 Journal RNA. 2011 Jul;17(7):1191-203.
Title piRNA profiling during specific stages of mouse spermatogenesis.
Authors Gan H, Lin X, Zhang Z, Zhang W, Liao S, Wang L, Han C.
PubMed 18922463 Journal Mol Cell. 2008 Sep 26;31(6):785-99.
Title A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.
Authors Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ.
PubMed 22020280 Journal Nature. 2011 Oct 23;480(7376):259-63.
Title The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements.
Authors De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D.
PubMed 22902560 Journal Mol Cell. 2012 Sep 28;47(6):970-9.
Title A role for Fkbp6 and the chaperone machinery in piRNA amplification and transposon silencing.
Authors Xiol J, Cora E, Koglgruber R, Chuma S, Subramanian S, Hosokawa M, Reuter M, Yang Z, Berninger P, Palencia A, Benes V, Penninger J, Sachidanandam R, Pillai RS.
PubMed 20022248 Journal Curr Biol. 2009 Dec 29;19(24):2066-76.
Title A broadly conserved pathway generates 3'UTR-directed primary piRNAs.
Authors Robine N, Lau NC, Balla S, Jin Z, Okamura K, Kuramochi-Miyagawa S, Blower MD, Lai EC.
PubMed 26588211 Journal PLoS Genet. 2015 Nov 20;11(11):e1005652
Title Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals
Authors Chirn GW,Rahman R,Sytnikova YA,Matts JA,Zeng M,Gerlach D,Yu M,Berger B,Naramura M, Kile BT,Lau NC.
PubMed 26115953 Journal Genes Dev. 2015 Jul 1; 29(13): 1403?415
Title RNF17 blocks promiscuous activity of PIWI proteins in mouse testes
Authors Wasik KA, Tam OH, Knott SR, Falciatori I, Hammell M, Vagin VV, Hannon GJ
PubMed 25262350 Journal Nucleic Acids Res. 2014 Oct 29;42(19):11903-11
Title HSP90a plays an important role in piRNA biogenesis and retrotransposon repression in mouse.
Authors Ichiyanagi T,Ichiyanagi K,Ogawa A,Kuramochi-Miyagawa S,Nakano T,Chuma S,Sasaki H,Udono H.
PubMed 32674113 Journal Nature. 2020 Aug;584(7822):635-639. doi: 10.1038/s41586-020-2557-5.
Title SPOCD1 is an essential executor of piRNA-directed de novo DNA methylation.
Authors Zoch A, Auchynnikava T, Berrens RV, Kabayama Y, Schöpp T, Heep M, Vasiliauskaitė L, Pérez-Rico YA, Cook AG, Shkumatava A, Rappsilber J, Allshire RC, O'Carroll D.
PubMed 23523368 Journal Mol Cell. 2013 Apr 11;50(1):67-81. doi: 10.1016/j.molcel.2013.02.016.
Title An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes
Authors Li XZ, Roy CK, Dong X, Bolcun-Filas E et al.