Loading...

Detail Information of piRNA: piR-hsa-9965

General Information
piRBase Id piR-hsa-9965 Accession DQ579710
Organism Human Number of methods 2
Sequence TGACCAGTTAATCTGTATCTGCTTGGAGCCC Number of papers 3
Length 31 Golden piRNA Y
Aliases piR-47822; PIR40821;
Datasets
Dataset Accession Reads PubMed Method Tissue
1 N/A N/A 16751776 small RNA testis
169 GSM1584523 1 25818294 oxidized small RNA adult ovary
175 GSM1584529 9 25818294 small RNA ovary from 2nd trimester embryos
176 GSM1584530 6 25818294 small RNA ovary from 2nd trimester embryos
177 GSM1584531 51 25818294 oxidized small RNA ovary from 2nd trimester embryos
178 GSM1584532 3 25818294 oxidized small RNA ovary from 2nd trimester embryos
265 GSM3517634 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
267 GSM3517636 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
268 GSM3517637 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult)
272 GSM3517642 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
275 GSM3517645 N/A 31358756 samll RNA(CAS-seq) 2 cell embryo(age: adult; spike in)
277 GSM3517647 N/A 31358756 samll RNA(CAS-seq) morula embryo(age: adult; spike in)
280 GSM3517660 N/A 31358756 IP Input oocyte(age: adult)
283 GSM3517668 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
284 GSM3517669 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
285 GSM3517670 N/A 31358756 samll RNA(CAS-seq) oocyte(age: adult; spike in)
286 GSM3517671 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
287 GSM3517672 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
288 GSM3517673 N/A 31358756 oxidized small RNA oocyte(age: adult; spike in)
Location in GRCh38
1 best hit(s) with 0 mismatch(es) in GRCh38
No. Location Gene RepeatMaker
Location 1 4:10120429-10120460:+
piRNA Expression
Sample CPM
GSM1584521 0
GSM1584522 0
GSM1584523 0.9518
GSM1584524 0
GSM1584525 0
GSM1584526 0
Sample CPM
GSM1584527 0
GSM1584528 0
GSM1584529 4.0027
GSM1584530 2.9452
GSM1584531 6.2626
GSM1584532 3.7635
The Expression of piRNA: piR-hsa-9965
Loading...

P value calculation
Sample1
Sample2
Target mRNA
No record.
Target lncRNA
No record.
Target Network
No record.
Disease Information
No record.
Reference
PubMed 16751776 Journal Nature. 2006 Jul 13;442(7099):199-202.
Title A germline-specific class of small RNAs binds mammalian Piwi proteins
Authors Girard A, Sachidanandam R, Hannon GJ, Carmell MA.
PubMed 25818294 Journal Cell Rep. 2015 Mar 31;10(12):2069-82.
Title Piwi proteins and piRNAs in mammalian oocytes and early embryos.
Authors Roovers EF, Rosenkranz D, Mahdipour M, Han CT, He N, Chuva de Sousa Lopes SM, van der Westerlaken LA, Zischler H, Butter F, Roelen BA, Ketting RF.
PubMed 31358756 Journal Nat Commun. 2019 Jul 29;10(1):3389. doi: 10.1038/s41467-019-11312-8.
Title Single-cell CAS-seq reveals a class of short PIWI-interacting RNAs in human oocytes.
Authors Yang Q, Li R, Lyu Q, Hou L, Liu Z, Sun Q, Liu M, Shi H, Xu B, Yin M, Yan Z,Huang Y, Liu M, Li Y, Wu L.